Typing tool

Complete norovirus genomes

KJ685417  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KJ685417                7509 bp ss-RNA     linear   VRL 28-JAN-2015
DEFINITION  Norovirus Hu/GII/BG1C0270/2011/BGD, complete genome.
VERSION     KJ685417.1
DBLINK      BioProject: PRJNA242747
SOURCE      Norovirus Hu/GII/BG1C0270/2011/BGD
  ORGANISM  Norovirus Hu/GII/BG1C0270/2011/BGD
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Das,S.R., Halpin,R.A., Mohan,M., Fedorova,N., Tsitrin,T., Puri,V.,
            Stockwell,T., Amedeo,P., Bishop,B., Gupta,N., Hoover,J., Katzel,D.,
            Schobel,S., Shrivastava,S., Ahmed,T., Haque,R., Knobler,S.,
            Miller,M., Wentworth,D.E. and Nelson,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-APR-2014) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 197.8x
            Sequencing Technology    :: Ion Torrent
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII/BG1C0270/2011/BGD"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: F; age: 274D"
                     /country="Bangladesh: Dhaka"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: GII"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caaatgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc ccccccgagg gaaaaaccac agagaccccc acgaccacct
      181 actccagaac tggttaaaaa tattccccct cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggtgtttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ccaacacggc cttcagtgtc cctccactca atcagaggga gaatagagac
      361 gctaaggagc cactcactgg aacaattctg gaaatgtggg acggggaaat ctaccattat
      421 ggcctgtatg tggagcgagg tcttgtacta ggtgtgcata aaccgccagc tgccatcagc
      481 ctcgctaagg ttgagctagc accactctcc ttgtactgga gacctgtgta cactcctcag
      541 tacctcatct ctccagatac tctcaagaaa ttgtccggag aaacgttccc ctacacagcc
      601 tttgacaaca actgttatgc cttttgttgc tgggtcctgg acctaaatga ctcgtggctg
      661 agcaggagaa tgatccagag gacaactggt ttcttcaggc cctaccaaga ctggaatagg
      721 aaaccccttc ccactatgga tgactccaaa ataaagaagg tagccaacat atttctgtgt
      781 gctttgtcct cgctattcac tagacccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacctttg cgggcatagt ggagtccctg
      901 atactcttgg cagaactctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac ttggtgacta cgagctacaa ggacctgagg accttgcagt ggagctcgtc
     1021 cccgtggtga tggggggaat tggtttggtg ctaggattca ccaaagagaa gattgggaaa
     1081 atgttgtcat ctgctgcgtc cactttgaga gcttgcaaag accttggtgc atatgggcta
     1141 gagatcctaa agttagtcat gaagtggttc ttcccgaaga aggaggaggc aaatgagctg
     1201 gctatagtga ggtccatcga ggatgcagtc ctggatctcg aggcaattga aaacaatcat
     1261 atgaccacct tgcttaaaga taaagacagt ctggcgacct acatgagaac acttgacctt
     1321 gaagaggaga aagccaggaa actctcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgccc tcctggcgag aatcgctgcc gcacgttctc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggtg ttgatgatat caggtaggcc aggaataggg
     1501 aagacccatc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagatcag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcgtacaa gggggagaga
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc atgatgccct caggctgcaa
     1681 gaactcgctg acacttgccc cctcactctg aactgtgaca ggattgaaaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcacc actaatctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ttcgaggcgc attgacttcc tcgtgtatgc agaagcccct
     1861 gaagtcgaaa aggcgaagcg tgatttccca ggccagcctg acatgtggaa gaacgctttc
     1921 agttctgatt tctcacacat aaaactagca ctggccccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aagactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggtta gatgaatttg aactgcaggg cccagctctc
     2101 accaccttca atttcgatcg caataaagtg cttgccttta gacagcttgc tgctgaaaat
     2161 aaatatggat tgatggacac aatgagggtt gggaaacagc tcaaggatgt cagaaccatg
     2221 ccagaactca aacaagcact caagaatgtc tcaatcaaga agtgtcaaat agtgtatagt
     2281 ggttgcacct acatgcttga gtctgatggc aagggcaatg tgaaagttga cagaatccaa
     2341 agcgccgccg tgcagaccaa caatgagctg gctggtgctc tgcaccactt gaggtgcgcc
     2401 agagtcagat actatgtcaa gtgtgtccag gaagccctgt attccatcat ccaaatcgct
     2461 ggagctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaga cctatggtcc
     2521 aagccacaag tggaaaacac agaggagact accagcaagg atgggtgccc aaaacctaag
     2581 gatgatgagg agtttgtcat ttcatccgac gacatcaaaa ctgagggcaa gaaggggaag
     2641 aacaagactg gccgtggcaa gaagcacaca gcattttcaa gcaaaggcct cagtgatgaa
     2701 gagtacgatg aatacaagag gattagagaa gaaaggaatg gcaagtactc tatagaagag
     2761 taccttcagg acagggacaa atattatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc aacaaggaaa
     2881 caacgcaagg aggaaagagt ctctctcggt ctggtcacag gctctgaaat taggaaaaga
     2941 aacccagatg acttcaaacc caaggggaaa ttgtgggctg acgatgacag gagtgtggac
     3001 tacaatgaga aactcagttt tgaggcccca ccaagcattt ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattctg ggtctccccc agtctgttca taacatcaac ccatgttata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt acacaagtca
     3181 ggcgagttct gtcgcttgag attccctaaa ccaatcagga ctgatgtgac gggcatgatc
     3241 ttagaagaag gcgcacctga gggcaccgtg gtcacactac tcatcaaaag gtccactggg
     3301 gaactcatgc ccctagcagc taggatgggg acccatgcga ccatgaagat ccaagggcgc
     3361 actgttgggg gccagatggg catgcttctg acaggatcca acgccaagag catggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatttaca agagaggtaa tgactatgtg
     3481 gtcattggag tccacacggc tgccgcacgt gggggaaata ctgtcatatg tgccacccag
     3541 gggagtgaag gagaggctac acttgagggt ggtgacaaca aggggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaca cttagcacca agaccaaatt ctggagatcg
     3661 tccacagcat cactcccacc tggcacctat gaaccagcct atcttggtgg caaggaccct
     3721 agagtcaagg gtggcccttc actgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gagcccaggg gtaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatt
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca agaccacttc cagtggtcat ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acagctgcgc tcaaggatga gttagttaaa
     4081 actgacaaaa tttatggtaa gatcaagaag aggcttctct ggggctcgga cttggcgacc
     4141 atggtccggt gtgctcgagc attcggaggc ctaatggatg aactcaaagc gcactgtgtc
     4201 acacttccca ttagagttgg catgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cattccaggt acacgtacca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agagccgtgt tggcagcagc tctagaaatc atggttaaat tctccccaga accacatttg
     4381 gctcaggtag tcgcggaaga cctcctttct cctagcgtgg tggacgtggg cgacttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctcccaatg gaattccatc
     4501 gcccactggc tcctcactct ctgtgcgctc tctgaagtca caaacctgtc tcctgatacc
     4561 atacaggcta attccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagagaaatt gacagcaaag ctcagagaat atgggttaaa gccaacccgc
     4681 cctgacaaaa ctgaagggcc ccttgtcatc tctgaagacc tgaatggcct aactttcctg
     4741 cggagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagttcaata
     4801 ctcaggcaaa tgtactggac taggggtccc aaccatggag acccatctga aacaatgatt
     4861 ccacactccc aaagacccat acaattgatg tccctactgg gggaggccgc tctccacggc
     4921 ccagcatttt acagcaaaat cagcaaattg gtcattgcag agctaaaaga aggtggtatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgtagttg gtgccgctat tgcggcacct gtagcgggcc agcaaaatgt
     5221 aattgacccc tggattagaa acaattttgt gcaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atttgaatcc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aatcctcgcg gggaatgcgt tcaccgccgg gaaaatcata tttgcagcag tcccacccaa
     5461 tttcccaact gaaggtttga gccccagcca agtcactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cttacccgat gttaggaata atttctatca
     5581 ttataatcag tcaaatgact ccaccatcaa attgatagca atgttgtaca caccacttag
     5641 ggctaacaat gccggggacg atgtcttcac agtttcttgt cgagtcctca cgagaccatc
     5701 ccccgatttt gatttcatat ttttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtccca gttttaactg ttgaggagat gaccaattca aggttcccca ttcctttgga
     5821 aaagttgttc acgggcccca gtagtgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtactaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggtgatgtc atccacattt caggcagtcg taactacaca atgaatttgg cctcccaaaa
     6001 ttggaacagt tacgatccaa cagaagaaat cccagccccc ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcacccaaac cacaaggaca gatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggta gggttcaatt
     6181 tgccactgac acagacaatg attttgtaac taatcaaaac acaaagttca ccccagtcgg
     6241 tgttatccag gatggtagca ctaccccccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggc agaaacactc ataatgtgca cctggccccc gctgtagccc ccactttccc
     6361 gggcgagcag ctcctcttct tcagatccac catgcccgga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtat ttctaccagg aggcagctcc
     6481 agcacaatct gatgtggcac tgttaagatt tgtgaatcca gacacaggta gggttttgtt
     6541 tgagtgtaag cttcataaat caggctatgt tacagtggct cacactggcc aacatgattt
     6601 agttatcccc cccaatggtt attttagatt tgattcctgg gtcaaccagt tctacacact
     6661 tgcccccatg ggaaatggga cggggcgtag acgtgcatta taatggctgg agccttcttt
     6721 gctggattgg catctgacgt ccttggctct ggacttagtt ccctaatcaa tgctggggct
     6781 ggggccatca accaaaaagt tgaatatgaa aacaacagaa aattgcaaca agcttctttc
     6841 caatttagta gcaatctaca acaggcttcc tttcaacatg acaaagagat gctccaagca
     6901 caaattgagg ccaccaaaaa gttgcaacag gaaatgatga gagttaaaca agcaatgctc
     6961 ctagagggtg ggttctctga gacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaaactttgg actggagcgg aacaaggtac tgggctcccg atgctaggac tacaacatac
     7081 aatgcaggcc gcttttccac ccctcaaccc tcgggggcac taccaggaag agctaatctc
     7141 agggctactg tccccgcccg gggttcctct agcacgtctt ctaactcttc tattgctact
     7201 tctgtgtatt caaatcaaac caccttaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gcctcccgtc aactgcaagg actaggagct gggttgagga tcaaaatagg
     7321 aatttgtcac ctttcatgag gggggcccac aacatctcgt ttgtcacccc accatctagc
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcaca ttcgcaagcg aggggagtca
     7501 cgggtgtaa