Typing tool

Complete norovirus genomes

KJ685412  GII.4 Sydney

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KJ685412                7509 bp ss-RNA     linear   VRL 28-JAN-2015
DEFINITION  Norovirus Hu/GII/BG1C0405/2012/BGD, complete genome.
VERSION     KJ685412.1
DBLINK      BioProject: PRJNA242747
SOURCE      Norovirus Hu/GII/BG1C0405/2012/BGD
  ORGANISM  Norovirus Hu/GII/BG1C0405/2012/BGD
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Das,S.R., Halpin,R.A., Mohan,M., Fedorova,N., Tsitrin,T., Puri,V.,
            Stockwell,T., Amedeo,P., Bishop,B., Gupta,N., Hoover,J., Katzel,D.,
            Schobel,S., Shrivastava,S., Ahmed,T., Haque,R., Knobler,S.,
            Miller,M., Wentworth,D.E. and Nelson,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-APR-2014) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 193.2x
            Sequencing Technology    :: Ion Torrent
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII/BG1C0405/2012/BGD"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: F; age: 124D"
                     /country="Bangladesh: Dhaka"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: GII"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ccaacagcaa caacgacatc
       61 gcaaaatctt caagtgacgg tgtgttttct aacatggctg tcacttttaa gcgggccctc
      121 ggggcgcggc ctaaacagcc gcccccgaag gaaataccac ccagaccccc gcgaccaccc
      181 acaccagaat tggtcaaaaa gatccctcct cccccaccca acggggagga tgaactagtg
      241 gtctcctaca gcgccaaaga tggcgtttcc ggactgcctg agctcactac tgtcagacaa
      301 ccggaagaaa ccaacacggc gtttagtgtc cccccactca accaaaggga gagcagggac
      361 gccaaggagc cactaactgg aacaattatt gaaatgtggg atggagagat ctaccattac
      421 ggcctgtacg tggaacgagg tcttatactt ggtgtgcaca agccaccggc agctatcagc
      481 cttgccaagg tcgagctaac accgctctct ttgttctgga gacctgtata caccccccag
      541 tatctcatct ctccagacac tcttaggaga ctacatggag agtcattccc ctacactgca
      601 tttgacaaca attgctacgc cttttgttgt tgggtattag acctaaacga ctcatggcta
      661 agcaggagaa tgattcagag aacaacaggt ttcttcaggc cgtaccagga ttggaacagg
      721 aagcccctcc ccactatgga tgattccaaa ttaaagaagg tagccaacat attcttgtgc
      781 actttgtctt cactattcac cagacccatt aaggacataa tagggaagtt gaaacctctt
      841 aacatcctta acattctggc tacatgtgat tggaccttcg caggcatagt ggaatcctta
      901 atactcttgg cagaactctt tggagttttc tggacacccc cagatgtgtc tgcgatgatc
      961 gcccccttgc taggtgatta tgaactgcaa ggacctgagg accttgcagt ggaactggtc
     1021 ccaatagtga tgggggggat aggtttggtg ctaggattta ccaaagagaa aattggaaag
     1081 atgctatcat ccgctgcatc cactttaaga gcttgtaaag accttggtgc atacggactg
     1141 gaaatcttaa aattggtcat gaagtggttc ttcccaaaga aagaggaagc aaacgaactg
     1201 gctatggtga gatccattga ggatgcagtg ttagacctcg aggcaattga aaacaaccac
     1261 atgaccaccc tactcaaaga caaagacagc ttggcaacct acatgagaac ccttgacctt
     1321 gaggaggaga aagccagaaa actctcaacc aaatctgctt cacccgatat tgtgggcaca
     1381 atcaactctc ttctggcaag aatcgctgct gcacgctccc tagtgcatcg ggcgaaagaa
     1441 gagctctcca gcaggccgag acctgtcgtt gtgatgatat cgggaaaacc agggataggg
     1501 aaaactcacc ttgccaggga gctggccaag aagatcgcgg cctccctcac aggggaccag
     1561 cgtgtgggtc ttatcccgcg caatggtgtc gaccactggg acgcatataa gggcgaaaga
     1621 gttgtcctat gggacgacta tggaatgagc aaccccatcc atgacgccct caggttgcag
     1681 gagcttgctg acacttgccc cctcacgcta aattgtgaca gaattgagaa caaagggaaa
     1741 gtctttgaca gtgatgccat aattatcacc accaatctgg ccaacccagc accactggat
     1801 tatgtcaact ttgaagcgtg ctcgagacgc attgacttcc tcgtgtacgc agaagcccct
     1861 gaggtggaga aggcaaagcg cgacttccca ggtcaacctg acatgtggaa ggacgctttc
     1921 agtcctgact tctcacacat aaaattgtca ttggctccac agggtggttt tgacaagaac
     1981 ggcaacaccc cgcatggaaa aggggtcatg aagaccctca ctactggctc cctcatcgcc
     2041 cgagcatcag ggttactcca tgagaggcta gatgaatatg aactgcaagg cccagccctc
     2101 accactttca actttgaccg caacaagata cttgctttta gacagcttgc tgctgaaaac
     2161 aagtatgggc tgatggacac aatgagagtt ggaaaacagc tcaaggatgt caagaccatg
     2221 tcagacctca aacaagcact caagaatatc gcgatcaaga agtgccagat agtgtacaat
     2281 ggtggcacct acacacttga ggccgatggc aagggtagtg tgaaagttga caaagtgcaa
     2341 agtgccactg tgcagaccaa caatgaacta gccggtgccc tacaccacct aaggtgcgct
     2401 agaatcagat actatgttaa gtgcgtccag gaggcactgt attccatcat ccaaatcgct
     2461 ggggctgcat tcgtcaccac gcgcatcgct aagcgcatga acatacagaa tctctggtcc
     2521 aagccacagg tggaagacac agaagaggtg gccaacaaag atggttgcct aaaacccaaa
     2581 gatgatgaag agtttgtcgt ctcatccgac gacatcaaaa ctgagggcaa gaaagggaag
     2641 aacaagtccg gccgtggcaa gaagcacaca gccttttcaa gcaaagggct cagtgatgag
     2701 gagtacgatg agtacaagag aatcagagaa gaaaggaatg gtaagtactc catagaagag
     2761 taccttcagg acagagacag gtactacgaa gaggtggcca ttgccagggc aaccgaagag
     2821 gacttctgtg aagaagaaga ggccaaaatc cggcagagaa ttttcagacc aacaaggaaa
     2881 caacgcaaag aagagagggc ctctctcggc ttggtcacag gctctgaaat caggaagaga
     2941 aacccagaag acttcaaacc caagggaaag ctgtgggctg atgatgacag aagtgttgac
     3001 tacaatgaga aactcaactt tgaggcccca ccaagcatct ggtcgcggat agtcaacttt
     3061 ggttcaggtt ggggcttctg ggtctccccc agtctgttta taacatcaac ccatgtcata
     3121 ccccaaggtg caatagagtt cttcggagtc cctatcaagc aaatccagat acacaaatca
     3181 ggtgaattct gccggttgag attcccaaag ccaatcagaa ctgatgtgac gggcatgatt
     3241 ctagaagaag gtgcgcccga ggggactgtg gccacactgc tcatcaagag accaactgga
     3301 gagctcatgc ctctggcagc cagaatgggg acccatgcaa ccatgagaat tcaggggcgc
     3361 acagttggag ggcaaatggg tatgctcctg acaggatcca acgccaagag tatggaccta
     3421 ggcacaacac caggcgactg cggctgcccc tacatctaca agagggggaa tgactacgtg
     3481 gtcataggag tccatacggc cgctgcccgt ggaggaaata ctgtcatatg tgccacccag
     3541 gggagtgagg gagaagccac acttgaagga ggtgacagta aagggacata ctgtggcgca
     3601 ccaatcttgg gcccagggag cgctccgaag ctcagtacca agactaagtt ttggagatca
     3661 tccacaacac cactcccacc tggcacctac gaaccagcct acctcggtgg caaagacccc
     3721 agagtcaaag gtggcccttc attgcaacaa gttatgaggg accagctaaa gccattcaca
     3781 gaacccagag gcaaaccacc aagaccaaat gtgttggaag ctgccaagaa aaccatcatc
     3841 aatgtccttg agcaaacaat tgatccaccc caaaaatggt catttgcgca agcttgcgca
     3901 tcccttgaca aaaccacctc cagcggccac ccgcaccaca tgcggaaaaa cgattgttgg
     3961 aatggggagt ccttcacagg aaaattggct gatcaggcct ccaaggccaa cctaatgttt
     4021 gaagagggaa agaacatgac tccagtctac acaggtgcac ttaaagatga gttggtaaag
     4081 accgataaag tttatggtaa gatcaagaag aggcttctgt ggggttcaga tctggcgacc
     4141 atgatacggt gcgcccgagc ttttggaggc cttatggatg aactcaaggc acactgtgtc
     4201 acacttcctg tcagagttgg tatgaacatg aatgaggatg gccccatcat ctttgagaag
     4261 cactccagat ataggtatca ctatgatgct gattattccc ggtgggactc aacacaacaa
     4321 agggatgtgc tagcagcagc actagaaatc atggttaagt tctctccaga accacacctg
     4381 gcccagatag ttgcagaaga cctcctttcc cctagcgtaa tggatgtagg tgactttcaa
     4441 atatcaataa gtgagggtct tccctctggg gtaccttgca cctcccagtg gaattccatc
     4501 gcccactggc tcctcactct ttgtgcactc tctgaagtca cggacctgtc ccctgacatc
     4561 attcaggcca actccctttt ctccttctat ggtgatgatg agattgtaag cacagacata
     4621 aagttggacc cagagaagct gacagcaaaa ctcaaggagt acgggctgaa accaacccgc
     4681 cccgacaaaa ctgaaggacc ccttgttatc tctgaagacc tggatggcct gacattcctc
     4741 cggagaactg tgacccgtga tccagctggc tggtttggaa aattggaaca aagttcaatt
     4801 ctcaggcaaa tgtactggac caggggtccc aaccatgaag acccatttga aacaatgata
     4861 ccacactccc aaagacccat acaactgatg tccttgctgg gcgaggctgc actccacggc
     4921 ccggcatttt atagcaaaat tagcaaatta gtcattgcag agttgaagga aggtggcatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccgcagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctctggag cccgttgttg gtgccgccat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa acaattttgt acaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttgggccctg atctaaatcc
     5341 ctacctatcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aattctcgcg gggaacgcgt tcaccgccgg gaaggtcata tttgcagcag tcccaccaaa
     5461 ttttccaact gaaggcttga gccccagcca ggtcactatg ttcccccata tagtagtaga
     5521 tgttaggcaa ctagaacctg tgttgattcc cttacccgat gttaggaata atttctatca
     5581 ttataatcaa tcaaatgacc ccaccattaa gttgatagca atgttgtata caccacttag
     5641 ggctaataat gctggggatg atgtcttcac agtttcttgc cgagttctca cgagaccatc
     5701 ccccgatttt gatttcatat ttctagtgcc acccacagtt gagtcaagaa ctaaaccatt
     5761 ctctgtccca gttttaactg ttgaggagat gaccaattca agattcccca ttcctttgga
     5821 aaagttgttc acgggtccca gcagtgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gcaccaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggagatgtc acccatatca ctggtagtca taactacaca atgaatttgg cttctcaaaa
     6001 ttggaacaat tatgacccaa cagaagaaat cccagcccct ctaggaactc cagattttgt
     6061 ggggaagatt caaggcgtgc tcacccaaac cacaaggaca gatggctcaa cacgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga ctttgctcca aaactgggta gagttcaatt
     6181 tgcaactgac acagaccatg attttgaagc taaccaaaac acaaagttca ccccagtcgg
     6241 tgtcatccaa gatggtggca ccacccaccg aaatgaaccc caacagtggg tgctcccaag
     6301 ttactcaggc agaaatactc ataatgtgca tctggccccc gctgtagccc ccacttttcc
     6361 gggtgagcaa cttctcttct tcagatccac catgcccgga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtac ttctaccaag aggcagcccc
     6481 agcacaatct gatgtggctc tgctaagatt tgtgaatcca gacacaggta gggttttgtt
     6541 tgagtgtaag cttcacaaat caggctatgt tacagtggct catactggcc aacatgattt
     6601 ggttatcccc cccaatggtt attttaggtt tgattcctgg gtcaaccagt tctacacgct
     6661 tgcccccatg ggaaatggaa cggggcgtag acgtgtagta taatggctgg agctttcttt
     6721 gctggattgg catctgatgt ccttggctct ggacttggtt cccttatcaa tgctggggct
     6781 ggggccatca accaaaaagt tgagtttgaa aataacagaa aattgcaaca agcatccttc
     6841 caatttagca gcaatctaca acaggcttcc tttcaacatg acaaagagat gctccaagca
     6901 caaattgagg ccaccaaaaa gctacaacag gaaatgatga aagttaagca ggcaatgctc
     6961 ctagagggtg ggttctctga gacagatgca gcccgcgggg caatcaacgc ccccatgaca
     7021 aaagctttgg actggagcgg gacaagatac tgggctcccg atgctaggac tacaacatac
     7081 aatgcaggcc gcttttccac ccctcaacca tcgggggtac tgccaggaag agctaatctt
     7141 agggatgctg tccctgctcg gggttcctcc agcaaatctt ctaactcttt tactgctact
     7201 tctgtgtact caaatcaaac tacttcaacg agacttggtt ctacagctgg ctctggtacc
     7261 agtgtctcga gcctcccgtc aactgcaagg actaggagct gggttgagga tcaaagcagg
     7321 aatttgtcac ctttcatgag gggggcccac aacatatcgt ttgtcacccc accatctagc
     7381 agatcctcca gccaaggcac agtctcaacc gtgcctaaag aggttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagccactc ttcgctcaca ttcgtaagcg aggggagtca
     7501 cgggtgtaa