Typing tool

Complete norovirus genomes

KJ685408  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KJ685408                7509 bp ss-RNA     linear   VRL 28-JAN-2015
DEFINITION  Norovirus Hu/GII/BG1C0066/2011/BGD, complete genome.
VERSION     KJ685408.1
DBLINK      BioProject: PRJNA242747
SOURCE      Norovirus Hu/GII/BG1C0066/2011/BGD
  ORGANISM  Norovirus Hu/GII/BG1C0066/2011/BGD
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Das,S.R., Halpin,R.A., Mohan,M., Fedorova,N., Tsitrin,T., Puri,V.,
            Stockwell,T., Amedeo,P., Bishop,B., Gupta,N., Hoover,J., Katzel,D.,
            Schobel,S., Shrivastava,S., Ahmed,T., Haque,R., Knobler,S.,
            Miller,M., Wentworth,D.E. and Nelson,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-APR-2014) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 178.3x
            Sequencing Technology    :: Ion Torrent
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII/BG1C0066/2011/BGD"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M; age: 295D"
                     /country="Bangladesh: Dhaka"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: GII"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctatcga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caagtgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc ttccccgagg gaaaaaccac aaagaccccc acgaccacct
      181 actccagaac tggttaaaaa tatgccccct cccccaccca acggagagga tgaaatagtg
      241 gtctcttata gtgtcaaaga tggtgtttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ctaacacggc ctttagtgtc cctccactca atcagaggga gaatagagat
      361 gctaaggagc cacttactgg aacaatcctg gaaatgtggg atggggaaat ctaccattat
      421 ggcctgtatg tggagcgagg tcttgtacta ggtgtgcaca aaccaccagc tgccatcagc
      481 ctcgctaagg ttgaactagc accactctcc ttgtactgga ggcctgtgta cacccctcag
      541 tacctcatct ctccagacac tctcaagaaa ttatccggag aaacgttccc ctacacagcc
      601 tttgacaaca actgttatgc cttttgttgc tgggtcctgg atctaaatga ctcgtggctg
      661 agcaggagaa tgatccagag aacaactggt ttcttcaggc cctaccaaga ctggaatagg
      721 aaacccctcc ccactatgga tgactccaaa ataaagaagg tggctaacat attcctgtgt
      781 gccctgtcct cgctgttcac cagacccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacttttg caggcatagt ggagtccctg
      901 atactcttgg cagaactctt cggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttgc ttggtgacta cgagctacaa ggacctgagg accttgcagt ggagctcgtc
     1021 cccgtggtga tggggggaat tggtttggtg ctaggattca ccaaagagaa gattggaaaa
     1081 atgttgtcat ctgctgcgtc caccttgaga gcctgtaaag accttggtgc atatgggcta
     1141 gagatcctaa agttggtcat gaagtggttc ttcccgaaga aggaggaggc aaatgagctg
     1201 gctatagtga ggtctatcga ggatgcagtc ctggatctcg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagt ctggcaacct atatgagaac acttgacctt
     1321 gaggaggaga aagccaggaa actctcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgccc tcctggcgag aatcgctgcc gcacgttctc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggtg ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc acgatgccct caggcttcaa
     1681 gaactcgctg acacttgccc cctcactcta aactgtgaca ggattgaaaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcacc actaatctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc atcgacttcc tcgtgtatgc agaagcccct
     1861 gaagtcgaaa aggcaaagcg tgacttccca ggccagcctg acatgtggaa gaacgctttc
     1921 agttctgatt tctcacacat aaaactagca ctggccccac agggtggctt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aagactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggtta gatgaatttg aactacaggg cccagctctc
     2101 accaccttca atttcgatcg caataaagta cttgccttta ggcagcttgc tgctgaaaat
     2161 aaatatggat tgatggacac aatgagagtt gggaaacagc ttaaggatgt cagaaccatg
     2221 ccagaactca aacaagcact caagaatgtc tcaatcaaga agtgccaaat agtgtacagt
     2281 ggctgcacct acatacttga gtctgatggc aagggcaatg tgaaagttga cagaatccaa
     2341 agcgccgccg tgcagaccaa caatgagctg gctggtgccc tgcaccattt gaggtgcgcc
     2401 agaatcagat actatgtcaa gtgtgtccag gaggccctgt attccatcat tcaaattgct
     2461 ggggctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaga cctatggtcc
     2521 aagccacaag tggagaacac agaggagact accagcaagg acgggtgccc aaaacctaag
     2581 gatgatgagg agtttgtcat ttcatccgac gacatcaaaa ctgagggtaa gaaagggaag
     2641 aacaaaactg gccgcggcaa gaagcacaca gcattttcaa gcaaaggcct cagtgatgaa
     2701 gagtacgacg agtacaagag gattagagaa gaaaggaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca tcgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc aacaaggaaa
     2881 caacgcaagg aggaaagggc ctctctcggt ctggtcacag gctctgaaat taggaaaaga
     2941 aacccagacg acttcaaacc caaggggaaa ttgtgggctg acgatgacag gagcgtggac
     3001 tacaacgaga aactcagttt tgaggcccca ccaagcatct ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattctg ggtctccccc agtctgttca taacatcaac ccatgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt gcacaagtca
     3181 ggcgagttct gtcgcttgag attcccaaaa ccaatcagga ctgatgtgac gggcatgatc
     3241 ttagaagagg gcgcacctga gggcaccgta gtcacactac tcatcaaaag gtccaccggg
     3301 gaactcatgc ccctagcagc taggatgggg acccatgcga ccatgaagat ccaagggcgc
     3361 actgttggag gccagatggg catgcttctg acaggatcca acgccaagag catggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatctaca agagaggtaa tgattatgtg
     3481 gtcattggag tccacacggc tgccgcacgt ggggggaaca ctgtcatatg tgccacccag
     3541 gggagtgaag gagaggctac acttgaaggt ggtgacaaca aggggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaca cttagcacca agaccaaatt ctggagatcg
     3661 tccacagcac cactcccacc tggcacctat gaaccagctt atcttggtgg caaggaccct
     3721 agagtcaagg gtggcccttc tctgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gagcccaggg gcaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca aaaccacttc cagtggtcat ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acagctgcgc tcaaggatga gttagttaaa
     4081 actgataaaa tttatggtaa tatcaagaag aggctcctct ggggctcgga cctggcgacc
     4141 atgatccggt gtgctcgagc attcggaggc ctaatggatg aattcaaagc acactgtgtc
     4201 acacttccca ttagagttgg catgaatatg aatgaggatg gccccatcat cttcgagaag
     4261 cattccaggt acacatatca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agagccgtgt tggcagcagc tctagaaatc atggtcaagt tctccccaga accacatttg
     4381 gctcaagtag tcgcggaaga ccttctttct cctagcgtgg tggacgtggg cgacttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgtgcgctc tctgaagtca caaacctgtc ccctgatacc
     4561 atacaggcta actccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagagaaatt gacagcaaag ctcagagaat atgggttaaa accaacccgc
     4681 cctgacaaaa ccgaaggacc ccttgtcatc tctgaagacc tgaatggcct aactttcctg
     4741 cggagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagttcaata
     4801 ctcaggcaaa tgtactggac tagaggtccc aaccatggag acccatctga aacaatgatt
     4861 ccacactccc aaagacccat acaattgatg tccctactag gggaggccgc tctccacggc
     4921 ccagcatttt acagcaaaat cagcaaattg gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca ggagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgtggttg gtgccgcaat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa acaattttgt acaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atttgaaccc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcagac
     5401 aatcctcgcg gggaacgcgt tcaccgccgg gaaaatcata tttgcagcag tcccaccaaa
     5461 tttcccaact gaaggtttga gccccagcca ggttactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgattcc cttacccgat gttagaaata atttctacca
     5581 ttacaatcaa acaaatgacc ccaccatcaa attgatagca atgttgtaca caccacttag
     5641 ggccaataat gccggggacg atgtcttcac agtttcttgt cgagttctca caagaccatc
     5701 ccccgatttt gatttcatat ttttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtcccg gttttaactg ttgaggagat gaccaattca aggttcccca ttcctttgga
     5821 gaaattattc acgggcccca gtagtgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtactaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccacattt caggcagtcg taactacaca atgaatttgg cctcccaaaa
     6001 ttggaacagt tacgatccaa cagaagaaat cccagcccct ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcacccaaac cacaaggaca gatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggca gagttcaatt
     6181 tgccactgat acagacaatg attttgaaac taaccaaaat acaaagttca ccccagtcgg
     6241 tgttatccag gatggtggta ccacccacca aaatgaaccc caacaatggg tactcccaag
     6301 ttactcaggc agagacactc acaatgtgca cctggccccc gctgtagctc ccactttccc
     6361 gggcgagcag ctcctcttct tcagatctac tatgcccgga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtat ttttaccagg aggcagcccc
     6481 agcacaatct gatgtggctc tgttaagatt tgtgaatcca gatacaggta gggtcttgtt
     6541 tgagtgtaaa cttcataaat caggctatgt tacagtggct cacactggcc aacatgattt
     6601 ggttatcccc cccaatggtt attttagatt tgactcctgg gtcaaccagt tctacacact
     6661 tgcccccatg ggaaatggga cggggcgtag acgtgcacta taatggctgg agctttcttt
     6721 gctggattgg catctgacgt ccttggctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggccatca accaaaaagt tgaatttgaa aacaacagaa aactgcaaca agcttccttc
     6841 caatttagca gcaatctaca acaggcttcc tttcaacatg acaaagagat gcttcaagca
     6901 caaattgagg ccaccaaaaa gttgcaacag gaaatgatga gagttaaaca agtaatgctc
     6961 ctagagggtg gattctctga gacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaagctttgg actggagcgg gacaaggtac tgggctcccg atgctaggac tacaacatat
     7081 aatgcaggcc gcttttccac ccctcaaccc tcgggggcac tatcaggaag agctaatctt
     7141 agggctactg cccccgcccg gggttcctcc agtacgtctt ctaactcttc tattgctact
     7201 tctgtgtatt caaatcaaac cacctcaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gccccccgtc aactgcaagg actaggagct gggttgagga tcaaaacagg
     7321 aatttatcac ctttcatgag gggggcccac aacatctcat ttgtcacccc accatctagc
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcata ttcgcaagcg aggggagtca
     7501 cgggtgtaa