Typing tool

Complete norovirus genomes

KJ685405  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KJ685405                7509 bp ss-RNA     linear   VRL 28-JAN-2015
DEFINITION  Norovirus Hu/GII/BG1C0282/2011/BGD, complete genome.
VERSION     KJ685405.1
DBLINK      BioProject: PRJNA242747
SOURCE      Norovirus Hu/GII/BG1C0282/2011/BGD
  ORGANISM  Norovirus Hu/GII/BG1C0282/2011/BGD
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Das,S.R., Halpin,R.A., Mohan,M., Fedorova,N., Tsitrin,T., Puri,V.,
            Stockwell,T., Amedeo,P., Bishop,B., Gupta,N., Hoover,J., Katzel,D.,
            Schobel,S., Shrivastava,S., Ahmed,T., Haque,R., Knobler,S.,
            Miller,M., Wentworth,D.E. and Nelson,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-APR-2014) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 197.8x
            Sequencing Technology    :: Ion Torrent
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII/BG1C0282/2011/BGD"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M; age: 179D"
                     /country="Bangladesh: Dhaka"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: GII"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caagtgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagtc tcccccgagg gaaaaaccac agagaccccc acgaccaccc
      181 actccagaac tggttaaaaa tatgccccct cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggtgtttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ctaacacggc ctttagtgtc cctccactca atcagaggga aaatagagat
      361 gctaaggagc cacttactgg aacaattctg gaaatgtggg atggggaaat ttaccattat
      421 ggcctgtatg tggagcgagg ccttgtacta ggtgtgcaca gaccaccagc tgccatcagc
      481 ctcgctaagg ttgagctagc accactctcc ttgtactgga ggcctgtgta cacccctcag
      541 tacctcatct ctccagacac tctcaagaaa ttatctggag aaacgttccc ctacacagcc
      601 tttgacaaca actgttatgc cttttgttgc tgggtcctgg acctaaatga ctcgtggctg
      661 agcaggagaa tgatccaaag aacaactggt ttcttcaggc cctaccagga ctggaatagg
      721 aaacccctcc ccactatgga tgactctaaa ataaagaagg tagctaacat attcctgtgt
      781 gccctgtcct cgctgttcac cagacccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacttttg caggcatagt ggaatccctg
      901 atactcttgg cagaactctt cggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac ttggtgacta cgagctacaa ggacctgagg accttgcagt ggagctcgtc
     1021 cccgtggtga tggggggaat tggtttggtg ctaggattca ccaaagagaa gattggaaaa
     1081 atgttgtcat ctgctgcgtc caccttgaga gcctgtaaag accttggtgc atatgggctg
     1141 gagatcctaa agttggtcat gaagtggttc ttcccgaaga aggaggaggc aaatgagctg
     1201 gccatagtga ggtctatcga ggatgcagtc ctggatctcg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagt ctggcaacct atatgagaac acttgacctt
     1321 gaggaggaga aagccaggaa actttcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgccc tcctggcgag aatcgctgcc gcacgatctc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggtg ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcatacaa gggggagagg
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc acgatgccct caggcttcaa
     1681 gaactcgctg acacttgccc cctcactcta aactgtgaca ggattgaaaa taaagggaag
     1741 gtctttgaca gcgatgtcat cattatcacc actaatctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc atcgacttcc tcgtgtatgc agaagcccct
     1861 gaagtcgaaa aggcgaagcg tgacttccca ggccagcctg acatgtggaa gaacgctttc
     1921 agttctgact tctcacacat aaaactagca ctggccccgc agggtggctt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aagactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggtta gatgaatttg aactacaggg cccagctctc
     2101 accaccttca atttcgatcg caataaagta cttgccttta ggcagcttgc tgctgaaaat
     2161 aagtatggat tgatggacac aatgagagtt gggaaacagc tcaaggatgt cagaaccatg
     2221 ccagaactca aacaagcact caagaatgtc tcaatcaaga agtgccaaat agtgtacagt
     2281 ggttgcacct attcacttga atctgatggc aagggcaatg tgagagttga cagaatccaa
     2341 agcgccgccg tgcagaccaa caatgagctg actggtgccc tgcaccattt gaggtgcgcc
     2401 agaatcagat actatgtcaa gtgtgtccag gaggccctgt attccatcat tcaaattgct
     2461 ggggctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaga cctatggtcc
     2521 aagccacaag tggaaaacac agaggagact accagcaagg acgggtgccc aaaacctaaa
     2581 gatgatgagg agtttgtcat ttcatctgac gacatcaaaa ctgagggtaa gaaagggaag
     2641 aacaaaactg gccgcggcaa gaaacacaca gcattctcaa gcaaaggcct cagtgatgaa
     2701 gagtacgacg agtacaagag aattagagaa gaaaggaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc aacaagaaaa
     2881 caacgcaagg aggaaagggc ctctcttggt ctggtcacag gctctgaaat taggaaaaga
     2941 aacccagacg acttcaaacc caaggggaaa ttgtgggctg acgatgacag gagcgtggac
     3001 tacaatgaga aactcagttt tgaggcccca ccaagcatct ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattttg ggtctccccc agtctgttca taacatcaac ccatgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt gcacaagtca
     3181 ggcgagttct gtcgcttgag attcccaaaa ccaatcagga ctgatgtgac gggcatgatc
     3241 ttagaagaag gcgcacctga gggcaccgta gtcacactac tcatcaaaag gtccaccggg
     3301 gaactcatgc ccctagcagc taggatggga acccatgcga ccatgaagat ccaagggcgc
     3361 actgttggag gccagatggg catgctcctg acaggatcca acgccaagag catggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatctaca agagaggtaa tgactatgtg
     3481 gtcattggag tccacacggc tgccgcacgt gggggaaaca ctgtcatatg cgccacccag
     3541 ggaagtgaag gagaggctac acttgaaggt ggcgacaaca aggggacata ctgtggtgca
     3601 ccaatcctag gcccaggtag tgccccaaca cttagcacca agaccaaatt ctggagatcg
     3661 tccacagcat cactcccacc tggcacctat gaaccagctt atcttggtgg caaggatcct
     3721 agagtcaagg gtggcccttc actgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gagcccaggg gcaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca aaaccacttc cagtggtcat ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggcg gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acagctgcac tcaaggacga gttagttaaa
     4081 actgataaaa tttatggtaa gatcaagaag aggctcctct ggggctcgga cctggcaacc
     4141 atgatccggt gtgctcgagc gttcggaggc ctaatggatg aattcaaagc acactgtgtc
     4201 acactcccca ttagagttgg catgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cattccaggt atacatatca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agggccgtgt tggcagcagc tctagaaatc atggtcaaat tctccccaga accacatttg
     4381 gctcaagtag tcgcggaaga cctcctttct cctagcgtgg tggacgtggg cgacttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgtgcgctc tctgaagtca caaacctgtc ccctgatacc
     4561 atacaggcta actccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaactggacc cagagaagtt gacagcaaag ctcagagaat atgggttaaa gccaacccgc
     4681 cctgacaaaa ctgaaggacc ccttgtcatc tctgaagacc tgaatggcct aactttcctg
     4741 cgaagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagttcaata
     4801 ctcaggcaaa tgtactggac tagaggtccc aatcatggag acccatctga aacaatgatt
     4861 ccacactccc aaagacccat acaattgatg tccctactgg gggaggccgc tctccacggc
     4921 ccagcatttt acagcaaaat cagcaaattg gtcattgcag agctaaaaga aggcggcatg
     4981 gatttttacg tgcccagaca ggagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgtggttg gtgccgcaat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa acaattttgt acaagcccct ggtggagagt tcacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atttgaatcc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcagac
     5401 aatcctcgcg gggaacgcgt tcaccgccgg gaaaatcata tttgcagcag tcccaccaaa
     5461 tttcccaact gaaggtttga gccccagcca ggttactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgattcc cttacccgat gttagaaata atttctacca
     5581 ttacaaccaa acaaatgacc ccaccatcaa attgatagca atgttgtaca caccacttag
     5641 ggctaataat gccggggacg atgtcttcac agtctcttgt cgagttctca caagaccatc
     5701 ccccgatttt gatttcatat ttttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtcccg gttttgactg ttgaggagat gaccaattca aggttcccca ttcctttgga
     5821 gaaattgttc acgggcccca gtagtgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtactaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccacattt caggcagtcg taactacaca atgaatttgg cctcccaaaa
     6001 ttggaacagt tacgatccaa cagaagaaat cccagcccct ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcacccaaac cacaaggaca gatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggta gagttcaatt
     6181 tgccactgat acagacaatg attttgaaac taaccaaaat acaaagttca ccccagtcgg
     6241 tgttatccag gatggtggta ctacccaccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggc agaaacactc ataatgtgca cctggccccc gctgtagccc ccactttccc
     6361 gggcgagcag ctcctctttt tcagatctac tatgcccgga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtat ttttaccagg aggcagcccc
     6481 agcacaatct gatgtggctc tgttaagatt tgtgaatcca gatacaggta gggtcctgtt
     6541 tgagtgtaaa cttcataaat caggctatgt tacagtggct cacactggcc aacatgattt
     6601 ggttatcccc cccaatggtt attttagatt tgactcctgg gtcaaccagt tctatacact
     6661 tgcccccatg ggaaatggga cggggcgtag acgtgcatta taatggctgg agctttcttt
     6721 gctggattgg catctgacgt ccttggctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggctatca accaaaaggt tgaatttgaa aacaacagaa aactgcaaca agcttccttc
     6841 caatttagca gcaatctaca acaggcttcc tttcaacatg acaaagagat gcttcaagca
     6901 caaattgagg ccaccaaaaa gttgcaacag gaaatgatga gagtcaaaca agtaatgctc
     6961 ctagagggtg gattctctga gacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaagctttgg actggagcgg gacaaggtac tgggctcccg atgctaggac tacaacatat
     7081 aatgcaggcc gcttttccac ccctcaaccc tcgggggcac tgccaggaag agctaatctt
     7141 agggttactg cccccgcccg gggttcctcc agcacgtctt ctaactcttc tattgctact
     7201 tctgtgtatt caagtcaaac cacttcaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gtctcccttc aactgcaagg actaggagct gggttgagga tcaaaatagg
     7321 aatttatcac ctttcatgag gggggcccac aacatctcgt tcgtcacccc accatctagc
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcata ttcgcaagcg aggggagtca
     7501 cgggtgtaa