Typing tool

Complete norovirus genomes

KJ407076  GII.4 US95
 GII.P4 US95

Length: 7,506 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6700
ORF3: 6700..7506
LOCUS       KJ407076                7506 bp ss-RNA     linear   VRL 17-SEP-2015
DEFINITION  Norovirus Hu/GII.4/HS66/2001/USA, complete genome.
VERSION     KJ407076.1
DBLINK      BioProject: PRJNA222778
SOURCE      Norovirus Hu/GII.4/HS66/2001/USA
  ORGANISM  Norovirus Hu/GII.4/HS66/2001/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7506)
  AUTHORS   Das,S., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            Stockwell,T., Amedeo,P., Bishop,B., Edworthy,P., Gupta,N.,
            Hoover,J., Katzel,D., Schobel,S., Shrivastava,S., Scheuer,K.,
            Takanashi,S., Wang,Q., Wentworth,D.E. and Saif,L.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-FEB-2014) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 826.4x
            Sequencing Technology    :: Ion Torrent
FEATURES             Location/Qualifiers
     source          1..7506
                     /organism="Norovirus Hu/GII.4/HS66/2001/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: F; age: 30Y"
                     /country="USA: OH"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: 2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 11_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 11_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 12_Forward, fwd_seq:
                     cagtytcttgtcgrgtyctca, rev_name: 12_Reverse, rev_seq:
                     /note="genotype: GII.4"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..13
     gene            5081..6700
     CDS             5081..6700
                     /product="capsid protein VP1"
     gene            6700..7506
     CDS             6700..7506
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ccaacagcaa caacgacacc
       61 gcaaaatctt caagcgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc ccccccgagg gaaataccac aaagaccccc acgaccaccc
      181 accccagaac tggtcaaaaa gatcccccct cccccgccca acggggagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggcgtttcc ggtttgcctg agctttccac cgtcaggcaa
      301 ccggaagaag ccaacacggc cttcagtgtc cccccactca accagaggga aaatagagat
      361 gctaaggagc cattgactgg aacaattctg gaaatgtggg atggggagat ctaccattac
      421 ggcctatatg tggagcgagg tcttatactt ggtgtgcaca aaccaccagc tgccattagc
      481 ctcgccaagg tcgagctgac accactctcc ttgttttgga gacctgtgta tactccccag
      541 tatctcattt ctccagacac tctcaagaaa ttacacggag aatcgtttcc ctacacagcc
      601 tttgacaaca attgttatgc cttctgttgc tgggtcttgg acctaaacga ctcgtggctg
      661 agtaggagaa tgatccagag aacaaccggt ttcttcagac cctaccaaga ttggaatagg
      721 aaacccctcc ccactatgga tgattccaaa ttaaagaagg tagctaatat attcctgtgt
      781 gctctatctt cactattcac caggcccata aaagacataa tagggaagct aaggcctctt
      841 aacatcctta acatcttagc ctcatgtgat tggactttcg caggcatggt ggaatccttg
      901 atactcttgg cagagctctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac tcggtgatta cgagttacaa ggacccgagg accttgcagt ggaactcgtt
     1021 cctgtagtga tggggggaat tggtctggtg ctaggattta ccaaagagaa gattggaaaa
     1081 atgttgtcat ctgctgcatc caccttaaaa gcttgtaaag atcttggtgc atacgggctg
     1141 gaaatcctaa agttagtcat gaagtggttc ttcccaaaga aagatgaagc aaatgaactg
     1201 gctatggtga gatccatcga ggatgcagtg ctggatctcg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagt ctggcaacct acatgaggac ccttgacctt
     1321 gaggaggaga aagccagaaa gctctcaacc aagtccgcat cacctgacat cgtgggcaca
     1381 atcaacgccc ttctggcgag aatcgctgct gcacgttccc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccgag acctgttgtc ttgatgatat caggcagacc aggaataggg
     1501 aagacccacc ttgctaggga ggtggccaag agaatcgcag cctccctcac aggagaccag
     1561 cgcgtaggcc tcgtcccacg caatggcgtc gatcactggg atgcatacaa gggggagagg
     1621 gtcgtcctat gggacgacta tgggatgagc aatcccatcc acgatgccct caggttgcaa
     1681 gaactcgctg acacttgccc cctcactcta aactgtgaca ggattgagaa caaaggaaag
     1741 gtctttgaca gtgatgtcat aattatcacc actaacctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaggcatg ctcgaggcgc atcgatttcc tcgtgtatgc agaagcccct
     1861 gaagtcgaaa aggcgaaacg cgacttccca ggccaacctg acatgtggaa gaacgctttc
     1921 agttctgatt tctcacacat aaaactaaca ctggctccac agggtggctt cgataagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aagactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggcta gatgagtttg aactacaggg cccagatctc
     2101 accaccttca actttgatcg caacaaagtg cttgccttta ggcagcttgc tgctgaaaac
     2161 aaatacgggt tgatggacac aatgaaagtt ggaaggcagc tcaaggatgt cagaaccatg
     2221 ccagatctta aacaagcact caaagatatc tcaatcaaga agtgccagat agtgtacagt
     2281 ggttgcacct atacacttga gtctgatggc aagggcaatg tgaaagttga cagagttcag
     2341 agcgcctccg tgcagaccaa caacgagctg gccggcgccc tacaccatct aaggtgcgcc
     2401 agaatcaggt actacgtcaa gtgtgtccag gaggccctgt attccatcat ccaaattgct
     2461 ggagctgcat ttgtcaccac gcgcatcgtc aagcgcatga acatacaaga cctctggtcc
     2521 aagccacaag tggaagacac aggggaggct accaacaagg acgggtgcct aaaacctaaa
     2581 gatgatgagg agttcgtcat ttcatccgac gatatcaaaa ctgagggcaa gaaagggaag
     2641 aacaagactg gccgcggcaa gaagcacaca gccttctcga gcaaaggtct cagtgatgag
     2701 gagtacgacg agtacaagag aattagagaa gaaagaaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gaccgaggaa
     2821 gacttctgcg aagaggagga ggccaagatt cggcaaagga ttttcaggcc aacaaggaaa
     2881 caacgcaagg aggaaagggc ctctctcggt ttagtcacag gttctgaaat caggaaaagg
     2941 aacccagatg atttcaagcc caaggggaaa ctgtgggctg atgatgacag aagtgtggac
     3001 tacaatgaga aactcagttt tgaggcccca ccaagcatct ggtcgaggat agtcaacttt
     3061 ggttcaggtt ggggcttttg ggtctctccc agtctgttca taacatcaac ccatgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaagc aaattcagat acacaaatca
     3181 ggcgaattct gtcgcttgag gttcccaaaa ccaatcagga ctgatgtggc gggcatgatc
     3241 ttagaagaag gtgcgcccga aggcaccgtg gtcacactac tcatcaagag acctactgga
     3301 gaacttatgc ccctagcagc tagaatgggg acccatgcaa ccatgaaaat tcaagggcgc
     3361 actgttggag gtcagatggg catgcttctg acaggatcca acgccaaaag catggaccta
     3421 ggcaccacac caggtgactg cggctgcccc tacatctaca agagggaaaa tgactatgtg
     3481 gttattgggg tccacacggc tgccgctcgt gggggaaaca ctgtcatatg tgccacccag
     3541 gggagtgagg gggaggctac acttgaaggt ggtgacagta agggaacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaaa ctcagcacca agaccaaatt ctggagatcg
     3661 tccactacac cactcccacc tggcacctat gaaccagcct atcttggtgg taaggacccc
     3721 agagtcaagg gtggcccttc attgcaacaa gttatgaggg atcagttgaa accatttaca
     3781 gagcccaggg gcaaaccacc aaagccaagt gtgttggaag ctgccaagaa aaccgtcatc
     3841 aatgtccttg aacaaacaat cgacccaccc gagaaatggt cattcacgca agcttgcgcg
     3901 tcccttgata agactacttc cagtggccac ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggatt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttc
     4021 gaagagggga agaacatgac cccagtttac acaggtgcgc ttaaggatga gttagttaaa
     4081 actgacaaaa tttatggtaa gatcaagaag aggcttctct ggggctcgga cttagcgacc
     4141 atgatccggt gcgctcgagc attcggaggc ttaatggatg aactcaaagc gcactgtgtt
     4201 acacttccta tcagagttgg tatgaatatg aatgaggacg gccccatcat cttcgagaga
     4261 cattccaggt acaaatatca ctatgatgct gactactctc ggtgggattc aacacaacag
     4321 agagccgtgt tggcagcagc cctagaaatc atggttaaat tctcctcaga accacatttg
     4381 gctcaggtgg tcgcagaaga ccttctttct cctagcgtgg tggatgtggg tgacttcaaa
     4441 atatcaatca atgagggtct cccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgtgcgctc tctgaagtta caaacttgtc ccctgacatc
     4561 atacaggcta attccctctt ctccttttat ggtgatgatg aaattgttag tacagatata
     4621 aagttggacc cagagaaatt gacagcaaaa ctcaaggaat acgggctgaa accaacccgc
     4681 cctgacaaaa ctgaagggcc ccttgttatt tctgaagatt taaatggtct gaccttcctg
     4741 cggaggactg tgacccgcga cccagctggt tggtttggaa aattggagca gagttcaata
     4801 ctcagacaaa tgtactggac taggggtccc aaccatgaag acccatctga aacaatgatt
     4861 ccacattccc aaagacccat acaattgatg tccctactgg gagaggccgc actccacggc
     4921 ccatcattct acagcaaaat tagcaagttg gttattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca agagccaatg tttagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgaatga
     5101 cgccagccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgttgttg gtgccgctat cgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa ataattttgt acaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccgggtg agatactatg gagcgcgccc ttgggccctg atttgaaccc
     5341 ctacctttct catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aatcctcgcg gggaacgcgt tcaccgccgg gaaaatcata tttgcagcag tcccaccaaa
     5461 ttttccaact gaaggcttga gccccagcca ggttactatg ttcccccata taatagtaga
     5521 tgttaggcaa ttggaacccg tgttgatccc cttacctgat gttaggaata acttctatca
     5581 ttataaccaa tcaaatgatt ctaccattaa attgatagca atgctgtata caccacttag
     5641 ggctaataat gctggggatg atgtcttcac agtctcttgt cgagtcctca cgaggccatc
     5701 ccccgatttt gatttcatat tcttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 caccgtccca atcttaactg ttgaggaaat gtccaactca agattcccca ttcctttgga
     5821 aaagttgtac acgggtccca gcagtgcttt tgttgtccaa ccacaaaatg gcaggtgcac
     5881 gactgacggc gtgctcttag gcactaccca gctgtctgct gtcaacatct gcaccttcag
     5941 aggggatgtc acccacattg caggcagtca tgactataca atgaatttgg cttctcaaaa
     6001 ttggaacaat tatgacccaa cagaagaaat cccagcccct ctgggaactc cagatttcgt
     6061 gggaaagatc caaggcatgc tcacccaaac cacaagagag gatggctcga cccgcgccca
     6121 caaagccaca gtgagcactg ggagtgtcca ctttactcca aagctgggca gtgttcaata
     6181 caccactgac acaaacaatg attttcaaac tggccaaaac acgaaattca ccccagtcgg
     6241 cgtcatccag gacggtaata accatcaaaa tgaaccccaa caatgggtac ttccaaatta
     6301 ctcaggtaga actggtcata atgtgcacct agctcctgcc gttgccccca ctttcccggg
     6361 tgagcaactt ctcttcttta ggtccactat gcccgggtgt agcgggtatc ccaacatgaa
     6421 tctggattgc ctactccccc aggaatgggt gcagcacttc taccaagaag cagccccagc
     6481 acaatctgat gtggctctgc tgagatttgt gaatccagac acaggtaggg ttctgtttga
     6541 gtgcaagctc cataaatcag gctatgtcac agtggctcac actggcccac atgatttggt
     6601 tatccccccc aatggttact ttagatttga ttcctgggtc aaccagttct acacacttgc
     6661 ccccatggga aatggagcgg ggcgcagacg tgtattataa tggctggagc tttctttgct
     6721 ggattggcat ctgatgtcct tggctctgga cttggttccc taatcaatgc tggggctggg
     6781 gccatcaacc aaaaagttga atttgaaaat aacagaaaat tgcaacaagc ttctttccaa
     6841 tttagtagca atctgcaaca ggcttccttc caacatgata aggagatgct ccaagcacaa
     6901 attgaggcca ctaagaaatt gcaacagggc atgatgaagg ttaaacaggc gatgctccta
     6961 gagggtggat tctctgaaac agatgcagcc cgtggggcaa ttaacgcccc catgacaaag
     7021 gctctggact ggagcggaac aaggtactgg gctcctgatg ccaggaccac aacatacaat
     7081 gcaggccgct tttccacccc tcaaccttcg ggggcattgc cagggagaaa taaccttagg
     7141 gccactgtcc ccgctcgggg ctcctctagc acactttcta gcattcccac tgctacttct
     7201 gtgtattcaa atcaaactgt ttcaacgaga cttggttctt cagctggttc tggcaccagt
     7261 gtctcgagtc ttccgtcaac tgcaaggact aggagctggg ttgaggatca aaacaaaaat
     7321 ttgtcacctt tcatgagggg ggctctcaac acatcattcg tcaccccacc atctagtaga
     7381 tcctctagcc aaggcacagt ctcaaccgtg cctaaagaaa ttttggactc ctggactggc
     7441 gctttcaaca cgcgcaggca gcctctcttc gctcacgttc gcaagcgagg ggagtcacgg
     7501 gtgtaa