Typing tool

Complete norovirus genomes

KJ407075  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KJ407075                7509 bp ss-RNA     linear   VRL 17-SEP-2015
DEFINITION  Norovirus Hu/GII.4/HS288/2012/USA, complete genome.
VERSION     KJ407075.1
DBLINK      BioProject: PRJNA222778
SOURCE      Norovirus Hu/GII.4/HS288/2012/USA
  ORGANISM  Norovirus Hu/GII.4/HS288/2012/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Das,S., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            Stockwell,T., Amedeo,P., Bishop,B., Edworthy,P., Gupta,N.,
            Hoover,J., Katzel,D., Schobel,S., Shrivastava,S., Scheuer,K.,
            Takanashi,S., Wang,Q., Wentworth,D.E. and Saif,L.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-FEB-2014) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 1220.7x
            Sequencing Technology    :: Ion Torrent
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII.4/HS288/2012/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M; age: 2Y"
                     /country="USA: Wooster, OH"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: 2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 11_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 11_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 12_Forward, fwd_seq:
                     cagtytcttgtcgrgtyctca, rev_name: 12_Reverse, rev_seq:
                     /note="genotype: GII.4"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..13
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctgacagcaa caacgacacc
       61 gtaaaatctt caagtgacgg aatgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaaaaccac aaagaccccc acgaccacct
      181 actccagaac tggttaaaaa tattcccccc cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggtgtttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ctaatacggc cttcagcgtc cctccactca atcagaggga gaatagagat
      361 gctaaggaac cacttactgg aacaattctg gaaatgtggg acggggaaat ctaccactat
      421 ggcctgtatg tggagcgagg tcttgtacta ggtgtgcaca aaccaccagc tgccatcagc
      481 ctcgctaagg ttgagctagc accactctcc ttgtactgga gacctgtgta cactcctcag
      541 tacctcatct ctccagacac tctcaagaaa ttatccggag aaacgttccc ctacacagcc
      601 tttgacaaca actgttatgc cttttgttgc tgggtcctgg acctaaatga ctcgtggctg
      661 agcaggagaa tgatccagag gacaactggc ttcttcagac cctaccaaga ctggaatagg
      721 aaaccccttc ccactatgga tgactccaaa ataaagaagg tagctaacat attcctgtgt
      781 gctctgtcct cgctgttcac cagacccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacttttg caggcatagt ggagtccctg
      901 atactcttgg cagaactctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac ttggtgacta cgagctacaa ggacctgagg acctcgcagt ggagctcgtc
     1021 cccgtggtga tggggggaat tggtttggtg ttaggattca ccaaagagaa gattgggaaa
     1081 atgttgtcat ctgccgcgtc caccttgaga gcctgcaaag accttggtgc atatgggcta
     1141 gagatcctaa agttggtcat gaagtggttc ttcccgaaga aggaggaggc aaacgagctg
     1201 gctatagtga ggtctatcga ggatgcagtc ctggatctcg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagc ctggcaacct atatgagaac actagacctt
     1321 gaggaggaga aagccaggaa actctcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgccc tcctggcgag aatcgctgcc gcacgttctc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggta ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc acgatgccct caggctgcaa
     1681 gaactcgctg acacttgccc cctcactcta aactgtgaca ggattgaaaa taaaggaaag
     1741 gtctttgaca gcgatgtcat catcatcacc actaatctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc atcgacttcc tcgtgtatgc agaagcccct
     1861 gaagtcgaaa aggcgaagcg tgacttccca ggccagcctg acatgtggaa gaacgctttc
     1921 agttctgatt tctcacacat aagactagca ctggccccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aaaactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggtta gatgaatttg aactacaggg cccagctatc
     2101 accaccttca atttcgatcg caataaagtg cttgccttta gacagcttgc tgctgaaaat
     2161 aaatatgggt tgatggacac aatgagggtt gggaaacagc tcaaggatgt caaaaccatg
     2221 ccagaactca aacaagcact caagaatgtc ttaatcaaaa agtgccaaat agtgtatagt
     2281 ggttgcacct acatacttga gtctgatggc aagggcaatg tgaaagttga cagagtccaa
     2341 agcgccgccg tgcagaccaa caatgagctg gctggtgccc tgcaccatct gaggtgcgcc
     2401 agaatcagat actatgtcaa gtgtgtccag gaggccctgt attccatcat tcaaattgct
     2461 ggggctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaga cctatggtcc
     2521 aagccacaag tggaaaacac agaggagacc accagcaagg acgggtgccc aaaacctaag
     2581 gatgatgagg agtttgtcat ttcatctgac gacatcaaaa ctgagggtaa gaaagggaag
     2641 aacaaaaccg gtcgcggcaa gaagcacaca gcattttcaa gcaaaggcct cagtgatgaa
     2701 gagtacgatg agtacaagag gattagagaa gaaaggaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc gacaagaaaa
     2881 caacgcaagg aggaaagatc ctctctcggt ctggtcacag gctctgaaat taggaaaaga
     2941 aacccagatg acttcaaacc caaggggaaa ttgtgggctg acgatgacag gagtgtggac
     3001 tacaatgaga aactcagttt tgaggcccca ccaagcatct ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattctg ggtctccccc agtctgttca taacatcaac ccatgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt acacaagtca
     3181 ggcgagttct gccgcttgag attcccaaaa ccaattagga ctgatgtgac gggcatgata
     3241 ttagaagaag gcgcacctga gggcaccgtg gtcacactac tcatcaaaag gtccactggg
     3301 gaactcatgc ccctagcagc taggatgggg acccatgcga ccatgaagat ccaagggcgc
     3361 actgttggag gccagatggg catgcttctg acaggatcca acgccaagag catggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatctata agaggggtaa tgactatgtg
     3481 gtcattggag tccacacggc tgccgcgcgt gggggaaaca ctgtcatatg tgccacccag
     3541 gggagtgaag gagaggccac acttgaaggt ggtgacaaca aggggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaca ctcagcacca agaccaaatt ctggagatcg
     3661 tccacagcat cactcccacc tggcacctat gaaccagcct atcttggtgg caaggaccct
     3721 agagtcaagg gtggcccttc actgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gagccaaggg gcaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca agaccacttc cagtggccat ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acagctgcgc tcaaggatga gttagttaaa
     4081 actgacaaaa tttatggtaa gatcaagaag aggcttctct ggggctcgga cttggcgacc
     4141 atgatccggt gtgctcgagc attcggaggc ctaatggatg aactcaaagc acactgtgtc
     4201 acacttccca ttagagttgg catgaatatg aatgaggatg gccccatcat ctttgagagg
     4261 cattccaggt acacatatca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agagccgtgt tggcagcagc tctggaaatc atggtcaaat tctccccaga accacacttg
     4381 gctcaggtag tcgcggaaga ccttctttct cctagcgtgg tggatgtggg cgatttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctctcaatg gaactccatc
     4501 gcccactggc ttctcactct ctgtgcgctc tctgaagtca caaacctatc ccctgatacc
     4561 atacaggcta actccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagagaaatt gacagcaaag ctcaaggagt atgggttaag accaacccgc
     4681 cctgacaaaa ctgaaggacc ccttgtcatc tctgaagacc tgaatggcct aactttcctg
     4741 cggagaactg tgacccgcga cccagctggt tggtttggaa aattggagca gagttcaata
     4801 ctcaggcaaa tgtattggac taggggtccc aaccatggag acccttctga aacaatgatt
     4861 ccacactccc aaagacccat acaattgatg tccctattgg gggaggccgc tctccacggc
     4921 ccagcatttt acagtaaaat cagcaaattg gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgtggttg gtgccgccat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa acaattttgt acaagcccct ggtggagagt tcacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atttgaatcc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aatcctcgcg gggaacgcgt tcaccgccgg gaaaatcata tttgcagcag tcccaccaaa
     5461 tttcccaact gaaggtttga gccccagcca ggtcactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cttacccgat gttaggaata atttctacca
     5581 ttataatcaa tcaaatgatt ccaccatcaa attgatagca atgttgtaca caccacttag
     5641 ggctaataat gccggggatg atgtcttcac agtttcttgt cgagttctta cgagaccatc
     5701 ccccgatttt gattttatat ttttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtccca attttaactg ttgaggagat gaccaattca aggttcccca ttcctttgga
     5821 aaagttgttc acgggcccca gtagtgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtaccactca actgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccatattc caggcagtca taactacaca atgaatttgg cctcccaaaa
     6001 ttggaacagt tacgatccaa cagaagaaat cccagcccct ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcactcaaac cactagtaca aatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggta gagtccaatt
     6181 tgccactgac acaaacaatg attttgaaac taaccaaaac acaaaattca ccccagtcgg
     6241 cgttatccag gatggtagta ccaccccccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggt agaaacattc acaatgtgca cctggccccc gctgtagccc ccactttccc
     6361 gggcgagcag ctcctcttct tcagatctac tatgcccgga tgcagcgggt accccaacat
     6421 ggacttggat tgtctgctcc cccaggaatg ggtgcagtac ttctaccagg aggcagcccc
     6481 agcacaatct gatgtggctc tgttaagatt tgtgaatcca gacacaggta gggttttgtt
     6541 tgagtgtaag cttcataaat caggctatgt tacagtggct catactggcc aacatgattt
     6601 ggttatcccc cccaatggtt attttagatt tgattcctgg gtcaaccagt tctacacact
     6661 tgcccccatg ggaaatggga cggggcgtag acgtgcatta taatggctgg agctttcttt
     6721 gctggattgg catctgacgt ccttggctct ggacttggtt ccctaatcaa tgctggggcc
     6781 ggggccatca accaaaaagt tgaatttgaa aataacagga aattgcaaca agcttctttc
     6841 caatttagca gcaatctaca acaggcttcc tttcaacatg acaaagagat gctccaagca
     6901 caaattgagg ccaccaaaaa gttgcaacag gaaatgatga gagttaaaca agcaatgctc
     6961 ctagagggtg gattctctga gacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaaactttgg actggagcgg gacaaggtac tgggctcccg atgctaggat tacaacatat
     7081 aatgcaggcc gctttcccac ccctcaactc tcgggggcac tgccaggaag agcaaatctt
     7141 agggctactg tccccgcccg gggctccccc agcacgtctt ctaactcttc tattgctact
     7201 tctgtgtatt caaatcaaac cacctcaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gcctcccgtc aactgcaagg actaggagct gggttgagga tcaaaatagg
     7321 aatttgtcac ctttcttgag gggggctcac aacatctcgt ttgtcacccc accatctagc
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcaca ttcgtaagcg aggggagtca
     7501 cgggtgtaa