Typing tool

Complete norovirus genomes

KJ407073  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KJ407073                7509 bp ss-RNA     linear   VRL 17-SEP-2015
DEFINITION  Norovirus Hu/GII.4/HS292/2012/USA, complete genome.
VERSION     KJ407073.1
DBLINK      BioProject: PRJNA222778
SOURCE      Norovirus Hu/GII.4/HS292/2012/USA
  ORGANISM  Norovirus Hu/GII.4/HS292/2012/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Das,S., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            Stockwell,T., Amedeo,P., Bishop,B., Edworthy,P., Gupta,N.,
            Hoover,J., Katzel,D., Schobel,S., Shrivastava,S., Scheuer,K.,
            Takanashi,S., Wang,Q., Wentworth,D.E. and Saif,L.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-FEB-2014) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 1243.2x
            Sequencing Technology    :: Ion Torrent
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII.4/HS292/2012/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M; age: 5Y"
                     /country="USA: Wooster, OH"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: 2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 11_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 11_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 12_Forward, fwd_seq:
                     cagtytcttgtcgrgtyctca, rev_name: 12_Reverse, rev_seq:
                     /note="genotype: GII.4"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..13
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacatc
       61 gcaaaatctt caagtgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaaaaccac aaagactccc acgaccacct
      181 actccagaac tggtcaaaaa tattccccct cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggtatttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ctaacacggc cttcagtgtc cctccactca atcagaggga gaatagagat
      361 gctaaggagc cacttactgg aacaattctg gagatgtggg acggggaaat ctaccattat
      421 ggcctgtatg tggagcgagg tcttgtacta ggtgtacaca aaccaccagc tgccatcagc
      481 ctcgctaagg ttgagctagc accactctcc ttgtactgga gacctgtgta cactcctcag
      541 tacctcatct ctccagacac tctcaagaaa ttatccggag aaacgtttcc ctacacagcc
      601 tttgacaaca actgttatgc cttttgttgc tgggtcctgg acctaaatga ctcgtggctg
      661 agcaggagaa tgatccagag aacaactggt ttcttcaggc cctaccaaga ctggaatagg
      721 aaaccccttc ccactatgga tgactccaaa ataaagaagg tagctaacat attcctgtgt
      781 gctctgtcct cgctgttcac tagacccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacttttg caggcatagt ggagtccctg
      901 atactcttgg cagaactctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac ttggtgacta cgagctacaa ggacctgagg accttgcagt ggagctcgtc
     1021 cccgtggtga tggggggaat tggtttggta ctaggattca ccaaagagaa gattggaaaa
     1081 atgttgtcat ctgctgcgtc caccttgaga gcttgtaaag accttggtgc atatgggcta
     1141 gagatcctaa agttggttat gaagtggttc ttcccgaaga aggaggaggc aaatgagctg
     1201 gctatagtga ggtctatcga ggatgcagtc ctagacctcg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagt ctggcaacct atatgagaac acttgacctt
     1321 gaggaggaga aagccaggaa actctcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgccc tcctggcgag aatcgctgcc gcacgttctc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggtg ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc acgatgccct caggctgcaa
     1681 gaactcgctg atacttgtcc cctcactcta aactgtgaca ggattgaaaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcacc actaatctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc atcgacttcc tcgtgtacgc agaagcccct
     1861 gaagttgaaa aggcgaagcg tgacttccca ggccagcctg acatgtggaa gaacgctttc
     1921 agttctgatt tctcacacat aaaactagca ctggccccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aagactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca cgagaggtta gatgaatttg aactacaggg cccagctctc
     2101 accaccttca atttcgatcg caataaagtg cttgccttta gacagcttgc tgctgaaaat
     2161 aaatatggat tgatggacac aatgagggtc gggaaacagc tcaaggatgt cagaaccatg
     2221 ccagaactca aacaagcact caagaacgtt tcaatcaaga agtgccaaat agtgtatagt
     2281 ggttgtacct acatacttga gtctgatggc aagggcaatg tgaaagttga cagaatccaa
     2341 agcgccgccg tgcagatcaa caacgagctg gctggtgccc tgcaccattt gaggagcgcc
     2401 agaatcagat actatgtcaa gtgtgcccag gaggccctgt attccatcat tcaaattgcc
     2461 ggggctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaaa cctatggtcc
     2521 aagccacaag tggaaaacac agaggagact accagcaagg acgggtgccc aaaacctaag
     2581 gatgatgagg agtttgtcat ttcatccgac gatatcaaaa ctgagggcaa gaaggggaaa
     2641 aacaagactg gccgcggcaa gaagcacaca gtattttcaa gcaaaggcct cagtgatgaa
     2701 gagtacgatg agtacaagag gattagagaa gaaaggaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc aacaaggaaa
     2881 caacgcaagg aggaaagagc cactctcggt ctggtcacag gctctgaaat taggaaaaga
     2941 aacccagatg acttcaaacc caaagggaaa ctgtgggctg acgatgacag gagtgtggac
     3001 tacaatgaga aactcagctt tgaggcccca ccaagcatct ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattctg ggtctccccc agtctgttca taacatcaac ccacgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt acacaagtca
     3181 ggcgagttct gtcgcttgag attcccaaaa ccaatcagga ctgatgtgac gggcatgatt
     3241 ttagaagaag gcgcacctga gggcaccgtg gccacactac tcatcaaaag gtccactggg
     3301 gaactcatgc ccctagcagc taggatgggg acccatgcga ctatgaagat ccaagggcgc
     3361 actgttggag gccagatggg catgcttctg acaggatcca acgccaagag catggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatctaca agagaggtaa tgactatgtg
     3481 gtcatcggag tccacacggc tgccgcacgt gggggaaaca ctgtcatatg tgccacccag
     3541 gggagtgagg gagaggctac acttgaaggt ggtgacaaca aggggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaca cttagcacca agaccaaatt ctggagatcg
     3661 tccacagtat cactcccacc tggcacctat gaaccagcct atcttggtgg caaggaccct
     3721 agagtcaagg gtggcccttc gttgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gaaccaaggg gcaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca agaccacttc cagtggtcat ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctagca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acagctgcgc tcaaggatga gttagttaaa
     4081 actgacaaaa tttatggtaa catcaagaag aggcttctct ggggctcgga cttggcgacc
     4141 atgatccggt gtgctcgagc tttcggaggc ctgatggatg agctcaaaac acactgtgtc
     4201 acgcttccca ttagagttgg catgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cattccaggt acacatatca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agggccgtgt tggcagcagc tctagaaatc atggttaaat tctccccaga accacatttg
     4381 gctcaggtag tcgcggaaga ccttctttct cctagcgtgg tggacgtggg cgacttcaca
     4441 atatcgatca acgagggcct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgtgcgctc tctgaagtca caaatctgtc ccctgatacc
     4561 atacaggcta actccctctt ctctttttat ggtgatgatg aaattgttag cacagatata
     4621 aaattggacc cagagaaatt gacagcaaag ctcagagagt atgggttaaa accaacccgc
     4681 cctgacaaaa ctgaaggacc ccttgtcatc tctgaagatc tgaatggcct aactttcctg
     4741 cggagaacag tgacccgcga cccagctggt tggtttggaa aactagagca gagttcaata
     4801 ctcaggcaaa tgtactggac taggggtccc aaccatggag acccgtctga aacaatgatt
     4861 ccacactccc aacgacccat acaactgatg tccctattgg gggaggccgc tctccacggc
     4921 ccagcctttt acagcaaaat cagcaaattg gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgaatga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgtagttg gtgccgccat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa ataattttgt acaagcccct ggtggagagt tcacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atctgaatcc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aatcctcgcg gggaacgcgt tcaccgccgg gaaaatcata tttgcagcag tcccaccaaa
     5461 tttcccaact gaaggtttga gccccagcca ggtcactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cttacccgat gttaggaaca atttctacca
     5581 ttataatcaa tcaaatgacc ccactatcaa attgatagca atgttgtaca caccacttag
     5641 ggctaataat gccggggacg atgtcttcac agtttcttgt cgagttctca cgagaccatc
     5701 ccccgatttt gacttcatat ttttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ttctgtccca gttttaactg ttgaggagat gaccaattca aggttcccca ttcctttgga
     5821 aaagttgttc acgggcccca gtagtgcctt tgttgttcaa ccacaaaatg gcaggtgcac
     5881 gactgatggc gtgctcctag gtactaccca actgtcccct gtcaacatct gcaccttcag
     5941 aggtgatgtc acccatatta caggcagtcg taactacaca atgaatttgg cctcccaaaa
     6001 ttggaacagt tacgatccaa cagaagaaat cccagcccct ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcacccaaac cacaaggaca gatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggca gagttcaatt
     6181 tgccactgac acagacaatg attttgaaac caaccaaaac acaaagttca ccccagtcgg
     6241 tgttatacag gatggtggca ccacccatcg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggc agaaatactc ataatgtgca tctggccccc gctgtagccc ccactttccc
     6361 aggcgagcag ctcctcttct tcagatctac tatgcccgga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtat ttctaccaag aggcagcccc
     6481 agcacaatct gatgtggctc ttttaaggtt tgtgaatcca gacacaggta gggttttgtt
     6541 tgagtgtaag ctccataaat caggctatgt tacagtggct cacactggtc aacatgattt
     6601 ggttatcccc cccaatggtt attttagatt tgattcctgg gtcaaccagt tctacacact
     6661 tgcccccatg ggaaatggga cggggcgtag acgtgcatta taatggctgg agctttcttt
     6721 gctggattgg catctgacgt ccttggctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggccatca accaaaaagt tgaatttgaa aataacagga aattgcaaca agcttccttc
     6841 caatttagta gcaatctaca acaggcttcc tttcaacatg acaaagagat gctccaagca
     6901 caaattgagg ccaccaaaaa gttgcaacaa gaaatgatga gagttaaaca agcaatgctc
     6961 ctagagggtg gattctctga gacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaaactttgg actggagcgg gacaaggtac tgggctcccg atgctaggac tacaacatat
     7081 aatgcaggcc gcttttccac cccccaaccc tcgggggcac taccaggaag agctaatctt
     7141 agggctaccg tccccgcccg gggttcctcc aacacgtctt caagctcttc tattgctact
     7201 tctgtgtatt caaatcaaac cacctcaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gcctcccgtc aactgcaagg actaggagtt gggttgagga tcaaaatagg
     7321 aatttgtcac ctttcatgag gggggcccac aacatctcgt ttgtcacccc accatctagc
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcaca ttcgtaagcg aggggagtca
     7501 cgggtgtaa