Typing tool

Complete norovirus genomes

KF429783  GI.1

Length: 7,617 | 3 CDS

ORF1: 2..5371
ORF2: 5355..6947
ORF3: 6947..7585
LOCUS       KF429783                7617 bp ss-RNA     linear   VRL 14-AUG-2013
DEFINITION  Norovirus Hu/GI.1/8K/1979/USA, complete genome.
VERSION     KF429783.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GI.1/8K/1979/USA
  ORGANISM  Norovirus Hu/GI.1/8K/1979/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7617)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (28-JUN-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 1899.9x
            Sequencing Technology    :: Illumina
FEATURES             Location/Qualifiers
     source          1..7617
                     /organism="Norovirus Hu/GI.1/8K/1979/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gaatgatgatggcgtcaa, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 2_Forward, fwd_seq:
                     gtcgttcctactgctgcta, rev_name: 2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tagtcatcaccaccaatgct, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     tttggtaagggtgtgatgaa, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     ccacgagattgtgaggtatg, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     cccagcactgtcaactaaaa, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     aatggttgggttggtaacat, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ctggtaatgcctttactgc, rev_name: 8_Reverse, rev_seq:
     gene            2..5371
     CDS             2..5371
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     2..1195
                     /product="protein p37"
     mat_peptide     1196..2284
     mat_peptide     2285..2887
                     /product="protein p20"
     mat_peptide     2888..3301
                     /product="viral genome-linked protein"
     mat_peptide     3302..3844
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3845..5368
                     /product="RNA-directed RNA polymerase"
     gene            5355..6947
     CDS             5355..6947
                     /product="capsid protein VP1"
     gene            6947..7585
     CDS             6947..7585
                     /note="minor capsid protein; basic protein"
                     /product="capsid protein VP2"
        1 aatgatgatg gcgtcaaaag acgtcgttcc tactgctgct agcagtgaaa atgctaacaa
       61 caatagtagt attaagtctc gtctattggc gagactcaag ggttcaggtg gggctacgtc
      121 cccacccaac tcgataaaga taaccaacca agatatggct ctggggctga ttggacaggt
      181 cccagcgcca aaggccacat ccgtcgatgt ccctaaacaa cagagggata gaccaccacg
      241 gactgttgcc gaagttcaac aaaatttgcg ttggactgag agaccacaag accagaatgt
      301 taagacgtgg gatgagcttg accacacaac aaaacaacag atacttgatg aacacgctga
      361 gtggtttgat gccggtggct taggtccaag tacactaccc actagtcatg aacggtacac
      421 acatgagaat gatgaaggcc accaggtaaa gtggtcggct agggaaggtg tagaccttgg
      481 catatccggg ctcacgacgg tgtctgggcc tgagtggaat atgtgcccgc taccaccagt
      541 tgaccaaagg agcacgacac ctgcaactga gcccacaatt ggtgacatga tcgaattcta
      601 tgaagggcac atctatcatt atgctatata cataggtcaa ggcaagacgg tgggtgtaca
      661 ctcccctcaa gcagccttct caataacgag gatcaccata cagcccatat cagcttggtg
      721 gcgagtctgt tatgtcccac aaccaaaaca gaggctcaca tacgaccaac tcaaagaatt
      781 agaaaatgaa ccatggccgt atgccgcagt cacgaacaac tgcttcgaat tttgttgcca
      841 ggtcatgtgc ttggaagata cttggttgca aaggaagctc atctcctctg gccggtttta
      901 ccacccgacc caagattggt cccgagacac tccagaattc caacaagaca gcaagttaga
      961 gatggttagg gatgcagtgc tagccgctat aaatgggttg gtgtcgcggc catttaaaga
     1021 tcttctgggt aagctcaaac ccttgaacgt gcttaactta ctttcaaact gtgattggac
     1081 gttcatgggg gtcgtggaga tggtggtcct ccttttagaa ctctttggaa tcttttggaa
     1141 cccacctgat gtttccaact ttatagcttc actcctgcca gatttccatc tacagggccc
     1201 cgaggacctt gccagggatc tcgtgccaat agtattgggg gggatcggct tagccatagg
     1261 attcaccaga gacaaggtaa gtaagatgat gaagaatgct gttgatggac ttcgtgcggc
     1321 aacccagctc ggtcaatatg gcctagaaat attctcatta ctaaagaagt acttcttcgg
     1381 tggtgatcaa acagagaaaa ccctaaaaga tattgagtca gcagttatag atatggaagt
     1441 actatcatct acatcagtga ctcagctcgt gagggacaaa cagtctgcac gggcttatat
     1501 ggccatctta gataatgaag aagaaaaggc aaggaaatta tctgtcagga atgccgaccc
     1561 acacgtagta tcctctacca atgctctcat atcccggatc tcaatggcta gggctgcatt
     1621 ggccaaggct caagctgaaa tgaccagcag gatgcgtcct gtggtcatta tgatgtgtgg
     1681 gccccctggt ataggtaaaa ccaaggcagc agaacatctg gctaaacgcc tagccaatga
     1741 gatacggcct ggtggtaagg ttgggctggt cccacgggag gcagtggatc attgggatgg
     1801 atatcacgga gaggaagtga tgctgtggga cgactatgga atgacaaaga tacaggaaga
     1861 ctgtaataaa ctgcaagcca tagccgactc agccccccta acactcaatt gtgaccgaat
     1921 agaaaacaag ggaatgcaat ttgtgtctga tgctatagtc atcaccacca atgctcctgg
     1981 cccagcccca gtggactttg tcaacctcgg gcctgtttgc cgaagggtgg acttccttgt
     2041 gtattgcacg gcacctgaag ttgaacacac gaggaaagtc agtcctgggg acacaactgc
     2101 actgaaagac tgcttcaagc ccgatttctc acatctaaaa atggagttgg ctccccaagg
     2161 gggctttgat aaccaaggga ataccccgtt tggtaagggt gtgatgaagc ccaccaccat
     2221 aaacaggctg ttaatccagg ctgtagcctt gacgatggag agacaggatg agttccaact
     2281 ccaggggcct acgtatgact ttgatactga cagagtagct gcgttcacga ggatggcccg
     2341 agccaacggg ttgggtctca tatccatggc ctccctaggc aaaaagctac gcagtgtcac
     2401 cactattgaa ggattaaaga atgctctatc aggctataaa atatcaaaat gcagtataca
     2461 atggcagtca agggtgtaca ttatagaatc agatggtgcc agtgtacaaa tcaaagaaga
     2521 caagcaagct ttgacccctc tgcagcagac aattaacacg gcctcacttg ccatcactcg
     2581 actcaaagca gctagggctg tggcatacgc ttcatgtttc cagtccgcca taactaccat
     2641 actacaaatg gcgggatctg cgctcgttat taatcgagcg gtcaagcgta tgtttggtac
     2701 ccgtacagca gccatggcat tagaaggacc tgggaaagaa cataattgca gggtccataa
     2761 ggctaaggaa gctggaaagg ggcccatagg tcatgatgac atggtagaaa ggtttggcct
     2821 atgtgaaact gaagaggagg agagtgagga ccaaattcaa atggtaccaa gtgatgccgt
     2881 cccagaagga aagaacaaag gcaagaccaa aaagggacgt ggtcgcaaaa ataactataa
     2941 tgcattctct cgccgtggtc tgagtgatga agaatatgaa gagtacaaaa agatcagaga
     3001 agaaaagaat ggcaattata gtatacaaga atacttggag gaccgccaac gatatgagga
     3061 agaattagca gaggtacagg caggtggtga tggtggcata ggagaaactg aaatggaaat
     3121 ccgtcacagg gtcttctata aatccaagag taagaaacac caacaagagc aacggcgaca
     3181 acttggtcta gtgactggat cagacatcag aaaacgtaag cccattgact ggaccccgcc
     3241 aaagaatgaa tgggcagatg atgacagaga ggtggattat aatgaaaaga tcaattttga
     3301 agctcccccg acactatgga gccgagtcac aaagtttgga tcaggatggg gcttttgggt
     3361 cagcccgaca gtgttcatca caaccacaca tgtagtgcca actggtgtga aagaattctt
     3421 tggtgagccc ctatctagta tagcaatcca ccaagcaggt gagttcacac aattcaggtt
     3481 ctcaaagaaa atgcgccctg acttgacagg tatggtcctt gaagaaggtt gccctgaagg
     3541 gacagtctgc tcagtcctaa ttaaacggga ttcgggtgaa ctacttccgc tagccgtccg
     3601 tatgggggct attgcctcca tgaggataca gggtcggctt gtccatggcc aatcagggat
     3661 gttactgaca ggggccaatg caaaggggat ggatcttggc actataccag gagactgcgg
     3721 ggcaccatac gtccacaagc gcgggaatga ctgggttgtg tgtggagtcc acgctgcagc
     3781 cacaaagtca ggcaacaccg tggtctgcgc tgtacaggct ggagagggcg aaaccgcact
     3841 agaaggtgga gacaaggggc attatgccgg ccacgagatt gtgaggtatg gaagtggccc
     3901 agcactgtca actaaaacaa aattctggag gtcctcccca gaaccactgc cccccggagt
     3961 atatgagcca gcatacctgg ggggcaagga cccccgtgta cagaatggcc catccctaca
     4021 acaggtacta cgtgaccaac tgaaaccctt tgcggacccc cgcggccgca tgcctgagcc
     4081 tggcctactg gaggctgcgg ttgagactgt aacatccatg ttagaacaga caatggatac
     4141 cccaagcccg tggtcttacg ctgatgcctg ccaatctctt gacaaaacta ctagttcggg
     4201 gtaccctcac cataaaagga agaatgatga ttggaatggc accaccttcg ttggagagct
     4261 cggtgagcaa gctgcacacg ccaacaatat gtatgagaat gctaaacata tgaaacccat
     4321 ttacactgca gccttaaaag atgaactagt caagccagaa aagatttatc aaaaagtcaa
     4381 gaagcgtcta ctatggggcg ccgatctcgg aacagtggtc agggccgccc gggcttttgg
     4441 cccattttgt gacgctataa aatcacatgt catcaaattg ccaataaaag ttggcatgaa
     4501 cacaatagaa gatggccccc tcatctatgc tgagcatgct aaatataaga atcattttga
     4561 tgcagattat acagcatggg actcaacaca aaatagacaa attatgacag aatccttctc
     4621 cattatgtcg cgccttacgg cctcaccaga attggccgag gttgtggccc aagatttgct
     4681 agcaccatct gagatggatg taggtgatta tgtcatcagg gtcaaagagg ggctgccatc
     4741 tggattccca tgtacttccc aggtgaacag cataaatcac tggataatta ctctctgtgc
     4801 actgtctgag gccactggtt tatcacctga tgtggtgcaa tccatgtcat atttctcatt
     4861 ttatggtgat gatgagattg tgtcaactga catagatttt gacccagccc gcctcactca
     4921 aattctcaag gaatatggcc tcaaaccaac aaggcctgac aaaacagaag gaccaataca
     4981 agtgaggaaa aatgtggatg gactggtctt cttgcggcgc accatttccc gtgatgcggc
     5041 agggttccaa ggcaggttag atagggcttc gattgaacgc caaatcttct ggacccgcgg
     5101 gcccaatcat tcagatccat cagagactct agtgccacac actcaaagaa aaatacagtt
     5161 gatttcactt ctaggggaag cttcactcca tggtgagaaa ttttacagaa agatttccag
     5221 caaggtcata catgaaatca agactggtgg attggaaatg tatgtcccag gatggcaggc
     5281 catgttccgc tggatgcgct tccatgacct cggattgtgg acaggagatc gcgatcttct
     5341 gcccgaattc gtaaatgatg atggcgtcta aggacgctac atcaagcgtg gatggcgcta
     5401 gtggcgctgg tcagttggta ccggaggtta atgcttctga ccctcttgca atggatcctg
     5461 tagcaggttc ttcgacagca gtcgcgactg ctggacaagt taatcctatt gatccctgga
     5521 taattaataa ttttgtgcaa gccccccaag gtgaatttac tatttcccca aataataccc
     5581 ccggtgatgt tttgtttgat ttgagtttgg gtccccatct taatcctttc ttgctccatc
     5641 tatcacaaat gtataatggt tgggttggta acatgagagt caggattatg ctagctggta
     5701 atgcctttac tgcggggaag ataatagttt cctgcatacc ccctggtttt ggttcacata
     5761 atcttactat agcacaagca actctctttc cacatgtgat tgctgatgtt aggactctag
     5821 accccattga ggtgcctttg gaagatgtta ggaatgttct ctttcataat aatgatagaa
     5881 atcaacaaac catgcgcctt gtgtgcatgc tgtacacccc cctccgcact ggtggtggta
     5941 ctggtgattc ttttgtagtt gcagggcgag ttatgacttg ccccagtcct gattttaatt
     6001 tcttgttttt agtccctcct acggtggagc agaaaaccag gcccttcaca ctcccaaatc
     6061 tgccattgag ttctctgtct aactcacgtg cccctctccc aatcagtagt atgggcattt
     6121 ccccagacaa tgtccagagt gtgcagttcc aaaatggtcg gtgtactctg gatggccgcc
     6181 tggttggcac caccccagtt tcattgtcac atgttgccaa gataagaggg acctccaatg
     6241 gcactgtaat caaccttact gaattggatg gcacaccctt tcaccctttt gagggccctg
     6301 cccccattgg gtttccagac ctcggtggtt gtgattggca tatcaatatg acacagtttg
     6361 gccattctag ccagacccag tatgatgtag acaccacccc tgacactttt gtcccccatc
     6421 ttggttcaat tcaggcaaat ggcattggca gtggtaatta tgttggtgtt cttagctgga
     6481 tttccccccc atcacacccg tctggctccc aagttgacct ttggaagatc cccaattatg
     6541 ggtcaagtat tacggaggca acacatctag ccccttctgt atacccccct ggtttcggag
     6601 aggtattggt ctttttcatg tcaaaaatgc caggtcctgg tgcttataat ttgccctgtc
     6661 tattaccaca agagtacatt tcacatcttg ctagtgaaca agcccctact gtaggtgagg
     6721 ctgccctgct ccactatgtt gaccctgata ccggtcggaa tcttggggaa ttcaaagcat
     6781 accctgatgg tttcctcact tgtgtcccca atggggctag ctcgggtcca caacagctgc
     6841 cgatcaatgg ggtctttgtc tttgtttcat gggtgtccag attttatcaa ttaaagcctg
     6901 tgggaactgc cagctcggca agaggtaggc ttggtctgcg ccgataatgg cccaagccat
     6961 aattggtgca attgctgctt ccacagcagg tagtgctctg ggagcgggca tacaggttgg
     7021 tggcgaagcg gccctccaaa gccaaaggta tcaacaaaat ttgcaactgc aagaaaattc
     7081 ttttaaacat gacagggaaa tgattgggta tcaggttgaa gcttcaaatc aattattggc
     7141 taaaaatttg gcaactagat attcactcct ccgtgctggg ggtttgacca gtgctgatgc
     7201 agcaagatct gtggcaggag ctccagtcac ccgcattgta gattggaatg gcgtgagagt
     7261 gtctgctccc gagtcctctg ctaccacatt gagatccggt ggcttcatgt cagttcccat
     7321 accatttgcc tctaagcaaa aacaggttca atcatctggt attagtaatc caaattattc
     7381 cccttcatcc atttctcgaa ccactagttg ggtcgagtca caaaactcat cgagatttgg
     7441 aaatctttct ccataccacg cggaggctct caatacagtg tggttgactc cacccggttc
     7501 aacagcctct tctacactgt cttctgtgcc acgtggttat ttcaatacag acaggttgcc
     7561 attattcgca aataataggc gatgatgttg taatatgaaa tgtgggcatc atattca