Typing tool

Complete norovirus genomes

KF429778  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KF429778                7509 bp ss-RNA     linear   VRL 24-OCT-2013
DEFINITION  Norovirus Hu/GII.4/NIHIC18.1/2012/USA, complete sequence.
VERSION     KF429778.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII.4/NIHIC18.1/2012/USA
  ORGANISM  Norovirus Hu/GII.4/NIHIC18.1/2012/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (28-JUN-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 1734.1x
            Sequencing Technology    :: Illumina
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII.4/NIHIC18.1/2012/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: 2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 11_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 11_Reverse, rev_seq:
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..13
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caagtgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaaaaccac aaagaccccc acgaccacct
      181 actccagaac tggttaaaaa tattccccct cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggtgtttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ccaacacggc cttcagtgtc cctccactca atcagaggga gaatagagat
      361 gctaaggaac cactcactgg aacaattctg gaaatgtggg acggggaaat ctaccattat
      421 ggcctgtatg tggagcgagg tcttgtacta ggtgtgcaca aaccgccagc tgccatcagc
      481 ctcgctaagg ttgagctagc accactctcc ttgtactgga gacctgtgta cactcctcag
      541 tacctcatct ctccagacac tctcaagaaa ttgtccggag aaacgttccc ctacacagct
      601 tttgacaaca actgttatgc cttttgttgc tgggttctgg acctaaatga ctcgtggctg
      661 agcaggagaa tgatccagag aacaactggt ttcttcaggc cctaccaaga ctggaatagg
      721 aaaccccttc ccactatgga tgactccaaa ataaagaagg tagctaacat atttctgtgt
      781 gctctgtcct cgctattcac caggcccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacctttg cgggcatagt ggagtccctg
      901 atactcttgg cagaactctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac ttggtgacta cgagctacaa gggcctgagg accttgcagt ggagctcgtc
     1021 cccgtggtga tggggggaat tggtttggtg ctaggattca ccaaagagaa gattgggaaa
     1081 atgttgtcat ctgctgcgtc caccttgaga gcttgcaaag accttggtgc atatgggcta
     1141 gagatcctaa agttagtcat gaagtggttc ttcccgaaga aggaggaggc aaatgagctg
     1201 gctatagtaa ggtccatcga ggatgcagtc ctggatctag aggcaattga aaacaatcat
     1261 atgaccacct tgcttaaaga taaagacagc ctggcaacct acatgaggac acttgacctt
     1321 gaagaggaga aagccaggaa actctcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgccc tcctggcgag aatcgctgcc gcacgttctc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggtg ttgatgatat caggcaggcc aggaatagga
     1501 aagacccacc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc acgatgccct caggctgcaa
     1681 gaactcgctg acacttgccc cctcactttg aactgtgaca ggattgaaaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cataatcacc actaatctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc attgacttcc tcgtgtatgc agaagcccct
     1861 gatgtcgaaa aggcgaagcg tgacttccca ggccagcctg acatgtggaa gaacgctttc
     1921 agttctgatt tctcacacat aaaactagca ctggccccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aagactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggtta gatgaatttg aactgcaggg cccagctctc
     2101 accaccttca atttcgatcg caataaagtg cttgccttta gacagcttgc tgctgaaaat
     2161 aagtatggat tgatggacac aatgagggtt gggaaacagc tcaaggatgt cagaaccatg
     2221 ccagaactta aacaagcact caagaatgtc tcaatcaaga agtgtcaaat agtgtatagt
     2281 ggttgcacct acatgcttga gtctgatggc aagggcaatg tgaaagttga caggatccaa
     2341 agcgccgccg tgcagaccaa caatgagctg gctggcgccc tgcatcactt gaggtgcgcc
     2401 agaatcagat actatgtcaa gtgtgtccag gaagctctgt attccatcat ccaaattgct
     2461 ggggctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaga cctatggtcc
     2521 aagccacaag tggaaaacac agaggagact accagcaagg acgggtgccc aaaacctaag
     2581 gatgatgagg agtttgtcat ttcatccgac gacatcaaaa ctgagggcaa gaaagggaag
     2641 aacaaggctg gccgtggcaa gaagcacaca gcattttcaa gcaaaggcct cagtgatgaa
     2701 gagtacgatg agtacaagag gattagagaa gagagaaatg gcaagtactc tatagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc aacaaggaaa
     2881 caacgcaagg aggaaagagt cactctcggt ttggtcacag gctctgaaat taggaaaaga
     2941 aacccagatg acttcaaacc caaggggaaa ttgtgggctg acgatgacag gagtgtggac
     3001 tacaatgaga aactcagttt tgaggcccca ccaagcattt ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattctg ggtctccccc agtctgttca taacatcaac ccatgttata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt acacaagtcg
     3181 ggcgagttct gtcgcttgag attccctaaa ccaatcagga ctgatgtgac gggcatgatc
     3241 ttagaagaag gcgcacctga gggcaccgtg gtcacactac tcatcaaaag gtccactggg
     3301 gagctcatgc ccctagcagc tagaatgggg acccatgcga ccatgaagat ccaagggcgc
     3361 actgttgggg gccagatggg catgcttctg acaggatcca acgccaagag catggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatctaca agagaggtaa tgactatgtg
     3481 gtcattggag tccacacggc tgccgcacgt ggggggaaca ctgtcatatg tgccacccag
     3541 gggagtgaag gagaggctac acttgagggt ggtgacaaca aggggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaca cttagcacca agaccaaata ctggagatcg
     3661 tccactgcat cactcccacc tggcacctat gaaccagcct atcttggtgg caaggaccct
     3721 agagtcaagg gtggcccttc actgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gagcccaggg gcaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatt
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca aaaccacttc cagtggtcat ccgcaccaca tgcggaagaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acagctgcgc tcaaggatga gttagttaaa
     4081 actgacaaaa tttatggtaa gatcaagaag aggcttcttt ggggctcgga cttggcgacc
     4141 atgatccggt gtgctcgagc attcggaggc ctaatggatg aactcaaagc gcactgtgtc
     4201 acacttccca ttagagttgg catgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cattccaggt acacgtacca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agagccgtgt tggcagcagc tctagaaatc atggttaaat tctccccaga accacatttg
     4381 gctcaggtag tcgcggaaga ccttctttct cctagcgtgg tggacgtggg cgacttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgtgcgctc tctgaagtca caaacctgtc tcctgatacc
     4561 atacaggcta attccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagagaaatt gacagcaaag ctcagagaat atgggttaaa accaacccgc
     4681 cctgacaaaa ctgaaggacc ccttgtcatc tctgaagacc tgaatggcct aactttcctg
     4741 cggagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagttcaata
     4801 ctcaggcaaa tgtactggac taggggtccc aaccatggag acccatctga aacaatgatt
     4861 ccacactccc aaagacccat acaattgatg tccctactgg gggaggccgc tctccacggc
     4921 ccagcttttt acagtaaaat cagcaaattg gtcattgcag agctaaaaga aggtggtatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgtagttg gtgccgctat tgcggcacct gtagcgggcc agcaaaatgt
     5221 aattgacccc tggattagaa acaattttgt acaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccaggtg agatactatg gagcgcgccc ttaggccctg atttgaatcc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aatcctcgcg gggaatgcgt tcaccgccgg gaaaatcata tttgcagcag tcccaccaaa
     5461 tttcccaact gaaggtttga gccccagcca agtcactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cttacccgat gttaggaata atttctacca
     5581 ctataatcag tcaaatgacc ccaccatcaa attgatagca atgttgtaca caccacttag
     5641 ggctaacaat gccggggacg atgtcttcac agtttcttgt cgagttctca cgagaccatc
     5701 ccccgatttt gacttcatat ttttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtccca gttttaactg ttgaggagat gaccaattca aggttcccca ttcctttgga
     5821 aaagttgttc acgggcccca gtagtgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtaccaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccacattg caggcagtcg taactacaca atgaatttgg cctcccaaaa
     6001 ttggaacagc tacgatccaa cagaagaaat cccagccccc ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcacccaaac cacaaggaca gatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggta gggttcaatt
     6181 tgccactgac acagacaatg attttgtaac taaccaaaac acaaagttca ccccagtcgg
     6241 tgtcatccag gatggtggta ctaccccccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggc agaaacactc acaatgtgca cctggccccc gctgtagccc ccactttccc
     6361 gggcgagcag ctcctcttct tcagatctac catgcccgga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtat ttctaccagg aagcagcccc
     6481 ggcacaatct gatgtggcac tgttaagatt tgtgaaccca gacacaggta gggtcttgtt
     6541 tgagtgtaaa cttcataaat caggctatgt tacagtggct cacactggcc aacatgattt
     6601 agttatcccc cccaatggtt attttagatt tgattcctgg gtcaaccagt tctacacact
     6661 tgcccccatg ggaaatggga cggggcgcag acgtgcatta taatggctgg agccttcttt
     6721 gctggattgg catctgacgt ccttggctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggccatca accaaaaagt cgaatttgaa aataacagaa aattgcaaca agcttccttc
     6841 caatttagta gcaatctaca acaggcttcc tttcaacatg acaaagagat gctccaagca
     6901 caaatcgagg ccaccaaaaa gttgcaacag gaaatgatga gagctaaaca agcaatgctc
     6961 ctagagggtg gattctctga gacagatgca gcccgtgggg cgatcaacgc ccccatgaca
     7021 aaaactttgg actggagcgg aacaaggtac tgggctcccg atgctaggac tacaacatac
     7081 agtgcaggcc gcttttccac ccctcagccc tcgggggcac taccaggaag agctaatctt
     7141 agggctactg tccccgcccg gggttcctcc agcacgtctt ctaactcttc tattgctact
     7201 tctgtgtatt caaatcaaac tacctcaacg agacttggtt ctacagccgg ttctggtacc
     7261 agtgtctcga gccttccgtc aactgcaagg accaggagct gggttgagga tcaaaatagg
     7321 aatttgtcac ctttcatgag gggggcccac aacatctcgt ttgtcacccc accatctagt
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcaca ttcgcaagcg aggggagtca
     7501 cgggtgtaa