Typing tool

Complete norovirus genomes

KF429777  GII.4 Den Haag
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KF429777                7509 bp ss-RNA     linear   VRL 24-OCT-2013
DEFINITION  Norovirus Hu/GII.4/NIHIC27.1/2012/USA, complete sequence.
VERSION     KF429777.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII.4/NIHIC27.1/2012/USA
  ORGANISM  Norovirus Hu/GII.4/NIHIC27.1/2012/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (28-JUN-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 639.7x
            Sequencing Technology    :: Illumina
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII.4/NIHIC27.1/2012/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: 2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 11_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 11_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 12_Forward, fwd_seq:
                     cagtytcttgtcgrgtyctca, rev_name: 12_Reverse, rev_seq:
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..13
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caagtgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaaaacccc aaagaccccc acgaccacct
      181 actccagaac tggttaaaaa tattccccct cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggtgtttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ccaacacggc cttcagtgtc cctccactca atcagaggga gaatagagat
      361 gctaaggagc cactcactgg aacaattctg gaaatgtggg acggggaaat ctaccattat
      421 ggcctgtatg tggagcgagg tcttgtacta ggtgtgcaca aaccgccagc tgccatcagc
      481 ctcgctaagg ttgagctagc accactctcc ttgtactgga gacctgtgta cactcctcag
      541 tacctcatct ctccagacac actcaagaaa ttgtccggag aaacgttccc ctacacagcc
      601 tttgacaaca actgttatgc cttttgttgc tgggtcctgg acctaaatga ctcgtggctg
      661 agcaggagaa tgatccagag gacaactggt ttcttcaggc cctaccaaga ctggaatagg
      721 aaaccccttc ccactatgga tgactccaaa ataaagaagg tagctaacat atttctgtgt
      781 gctctgtcct cgctattcac cagacccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacctttg cgggcatagt ggagtccctg
      901 atactcttgg cagaactctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac ttggtgacta cgagctacaa ggacctgagg accttgcggt ggagctcgtc
     1021 cccgtggtga tggggggaat tggtttggtg ctaggattca ccaaagagaa gattgggaaa
     1081 atgttgtcat ctgctgcgtc caccttgaga gcttgcaaag accttggtgc atatgggcta
     1141 gagatcctaa agttagtcat gaagtggttc ttcccgaaga aggaggaggc aaatgagctg
     1201 gctatagtga ggtccatcga ggatgcagtc ctggatctcg aggcaattga aaacaatcat
     1261 atgaccacct tactcaaaga taaagacagt ctggcaacct acatgagaac acttgacctt
     1321 gaagaggaga aagccaggaa actctcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgctc tcctggcgag aatcgccgcc gcacgttctc tggtgcatcg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggtg ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc acgacgccct caggctgcaa
     1681 gaactcgctg acacttgccc cctcactctg aactgtgaca ggattgaaaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcact actaatctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc attgacttcc tcgtgtatgc agaagcccct
     1861 gatgtcgaaa aggcgaagcg tgacttccca ggccaacctg acatgtggaa gaatgctttc
     1921 agttctgatt tctcacacat aaaactagca ctggccccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgtcatg aagactctca ccactggttc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggtta gatgaatttg aactgcaggg cccagctctc
     2101 accaccttca acttcgatcg caataaagtg cttgccttta gacagcttgc tgctgaaaat
     2161 aaatatggat tgatggacac aatgagggtt gggaaacagc tcaaggatgt cagaaccatg
     2221 ccagaactca aacaagcact caagaatgtc tcaatcaaga agtgtcaaat agtgtatagt
     2281 ggttgcacct acatgcttga gtctgatggc aagggcaatg tgaaagttga caggatccaa
     2341 agcgccgccg tgcagaccaa caatgagctg gctggtgccc tgcaccactt aaggtgtgcc
     2401 agaataagat actatgtcaa gtgtgtccag gaagccctgt attccatcat ccaaattgct
     2461 ggggctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaga cctatggtcc
     2521 aagccacaag tggaaaacac agaggagacc accagcaagg acgggtgccc aaaacctaag
     2581 gatgatgagg agtttgtcat ttcatccgac gacatcaaaa ctgagggcaa gaaagggaag
     2641 aacaagactg gccgtggcaa gaagcacaca gcattttcaa gtaaaggcct cagtgatgaa
     2701 gagtacgatg aatacaagag gattagagaa gaaagaaatg gcaagtactc tatagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc aacaaggaaa
     2881 caacgcaagg aggaaagagc ctccctcggt ttggtcacag gctctgaaat taggaaaaga
     2941 aacccagatg acttcaaacc caaggggaaa ttgtgggctg acgatgacag gagtgtggac
     3001 tacaatgaga aactcagttt tgaggcccca ccaagcattt ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattctg ggtctccccc agtctgttca taacatcaac ccatgttata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt acacaagtca
     3181 ggcgagttct gtcgcttgag attccctaaa ccaatcagga ctgatgtgac gggcatgatc
     3241 ttagaagaag gcgcacctga gggcaccgtg gtcacactac tcatcaaaag gcccactggg
     3301 gaactcatgc ccctagcagc taggatgggg acccatgcga ccatgaagat ccaagggcgc
     3361 actgttgggg gccagatggg catgcttctg acaggatcca acgccaagag tatggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatctaca agagaggtaa tgactatgtg
     3481 gtcattggag tccacacggc tgccgcacgt ggggggaaca ctgtcatatg tgccacccag
     3541 gggagtgaag gagaggctac acttgagggt ggtgacaaca agggaacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaca cttagcacca agaccaaatt ctggagatcg
     3661 tccacagcat cactcccacc tggcacctat gaaccagcct atcttggtgg caaggaccct
     3721 agagtcaagg gtggcccttc actgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gagcccaggg gcaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaagtggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca agaccacttc cagtggtcat ccgcatcaca tgcggaaaaa cgactgctgg
     3961 aatggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acagctgcgc tcaaggatga gttagttaaa
     4081 actgacaaaa tttatggtaa gatcaagaag aggcttcttt ggggctcgga cttggcgacc
     4141 atgatccggt gtgctcgagc attcggaggc ctaatggatg aactcaaagc gcactgtgtc
     4201 acactcccca ttagagttgg catgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cattccaggt acacgtacca ctatgatgct gattactctc ggtgggattc aacacaacag
     4321 agagccgtat tggcagcagc tctagaaatc atggttaaat tctccccaga accacaattg
     4381 gctcaggtag ttgcggaaga ccttctttct cctagcgtgg tggacgtggg cgacttcaca
     4441 atatcaatca atgagggtct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgtgcgctc tctgaagtca caaacctgtc tcctgacacc
     4561 atacaggcta attccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagagaaatt gacaacaaag ctcagagaat atgggttaaa accaacccgc
     4681 cctgacaaaa ctgaaggacc ccttgtcatc tctgaagacc tgaatggcct aacttttctg
     4741 cggagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagttcaata
     4801 ctcaggcaaa tgtactggac taggggtccc aaccacggag acccatctga aacaatgatc
     4861 ccacactccc aaagacccat acaattgatg tccctactgg gggaggccgc tctccacggc
     4921 ccagcatttt acagtaaaat cagcaaattg gtcattgcag agcttaaaga aggtggtatg
     4981 gatttttacg tgcccagaca agagcctatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccgcagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgttgtcg gtgccgctat tgcggcgcct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa gtaactttgt acaagcccct ggtggagagt tcacagtgtc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atctgaatcc
     5341 ctacctatct catttggcca gaatgtataa tggttatgca ggtggttttg aagtgcaggt
     5401 gatcctcgcg gggaacgcgt tcaccgcggg aaaaatcata tttgcagcag ttccaccaaa
     5461 ttttccaact gaaggcttga gtcccagcca agttactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cttacctgat gttaggaata acttctatca
     5581 ctataaccag tcaaatgatt ctaccattaa attgatagca atgctgtaca caccactcag
     5641 agccaataat gccggggatg atgtcttcac ggtctcttgt cgagtcctca cgaggccatc
     5701 ccctgatttt gacttcatat ttctggtgcc acctacagtt gagtcaagaa ctaagccatt
     5761 tactgtccca atcttgactg ttgaagaaat gaccaattca agattcccca ttcctttgga
     5821 gaaattgttc acgggtccca gcagtgcctt tgttgttcaa ccacaaaatg gcagatgcac
     5881 aactgatggc gtgctcttag gcaccaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccacattg cgggttcccg taattacaca atgaatttgg cctctctaaa
     6001 ttggagcaat tacgacccaa cagaagagat tccagcccct ctgggaactc cagatttcgt
     6061 gggaaagatc caaggtgtgc tcactcaaac cacaaaggga gatggctcga cccggggcca
     6121 taaagctaca gtttacactg ggagtgccga cttcactcca aagctgggca gtgttcaatt
     6181 tgctactgat acagaaaatg actttgaaac tcaccaaaac acaagattca ccccagtcgg
     6241 tgtcattcag gatggtggca ccacccaccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggt agaaatgtcc ataatgtaca cctagcccct gctgtagccc ccaattttcc
     6361 aggtgaacag ctccttttct tcaggtccac tatgcccgga tgtagcggat atcccaacat
     6421 ggatttggat tgcctactcc cccaggagtg ggtgcaacac ttttaccaag aggcagctcc
     6481 agcacaatct gatgtggctc tattgagatt tgtgaatcca gacacgggta gggtcttgtt
     6541 tgagtgcaaa ctccataaat caggctatgt cacagtggct cataccggcc aacatgattt
     6601 ggtcattccc cccaatggtt attttaggtt tgattcctgg gttaatcagt tctacacact
     6661 tgcccccatg ggaaatggaa cggggcgtag acgtgcttta taatggctgg agctttcttt
     6721 gctggattgg catctgatgt ccttagctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggctatca accaaaggat tgattttgaa aataatagaa aattgcagca agcttccttt
     6841 cagtttagta gtaatctaca acaagcttcc tttcaacatg ataaagagat gctccaagca
     6901 caaattgagg ctactaaaaa gttgcaacag gaactgatga aagtcaaaca ggcaatgctc
     6961 ttagaaggtg gattctctga aacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaggctttgg actggagtgg aacaaggtac tgggcccctg atgctaggac tacaacatac
     7081 aatgcaggcc gcttttctac ccctcaacct tcgggggcac tgccaggaag aatcaacccc
     7141 aggactccta tccccgcccg gggctcccca agcatatctt ccaatgtttc tactgctaat
     7201 tctatacatt caaatcaaac tgcttcaacg agacttggtt ctacagctgg ttctggcacc
     7261 gatgtctcga gtctcccgtc aactgcaagg actaggagtt gggttgagga tcaaaacaga
     7321 aatttatcac ctttcatgag gggggctcac aacatatcgt ttgtcacccc accatctagc
     7381 agatcctcca gccaaggcac agtctcaacc gtgcctaaag atgttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcaca ttcgtaggcg aggggagtca
     7501 cgggtgtaa