Typing tool

Complete norovirus genomes

KF429776  GII.4 Den Haag
 GII.P4 Den Haag

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KF429776                7509 bp ss-RNA     linear   VRL 24-OCT-2013
DEFINITION  Norovirus Hu/GII.4/NIHIC17.1/2012/USA, complete sequence.
VERSION     KF429776.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII.4/NIHIC17.1/2012/USA
  ORGANISM  Norovirus Hu/GII.4/NIHIC17.1/2012/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (28-JUN-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 2749.0x
            Sequencing Technology    :: Illumina
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII.4/NIHIC17.1/2012/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: 2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 11_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 11_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 12_Forward, fwd_seq:
                     cagtytcttgtcgrgtyctca, rev_name: 12_Reverse, rev_seq:
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctgacagcaa caacgacacc
       61 gcaaaatctt caaatgacaa aatgttttct aacatggctg tcactcttaa acgagccctc
      121 ggggcgcggc ctaaacagcc ccccccgagg gaaataccac aaagaccccc acgaccacct
      181 actccagaac tggtcaaaaa gatccctcct cccccgccca acggagagga tgaagtagtg
      241 gtttcttata gtgccaaaga tggcgtttcc ggtttgcctg agctttccac cgtcaggcaa
      301 ccggaagaaa ccaatacggc cttcagtgtc cctccactca atcagaggga gaatagggat
      361 gctaaggaac cactaactgg gacaattctg gaaatgtggg atggagaaat ctatcattac
      421 ggcctgtatg ttgagcgagg ttttgtgctg ggcgtacaca agccaccagc tgccattagc
      481 ctcgccaagg tcgaattaac accactctcc ttgttctgga gacctgtgta cactcctcag
      541 tacctcattt ctccagacac tctcaagaaa ttacacggag aaacatttcc ctacacagcc
      601 tttgacaaca attgctatgc cttttgttgc tgggtcctgg atttaaacga ctcgtggctg
      661 agtaggagaa tgatccagag aacaacaggc ttcttcagac cctaccaaga ttggaatagg
      721 aaacccctcc ccactatgga tgattccaaa ttaaagaagg tggctaacat attcctgtgc
      781 gccctgtctt cactattcac caggcctata aaagacataa taggaaagtt aaggcctctc
      841 aacatcatca acatcctggc ttcatgtgat tggactttcg caggcatagt ggagtccttg
      901 atactcttgg cggagctctt tggagtcttc tggacacccc cagatgtgtc tgcgatgatc
      961 gcccccttac tcggtgattt cgagttacaa ggacctgagg accttgtagt ggagctcgtc
     1021 cctgtggtaa tgggggggat tggtttggtg ctaggattca ccaaagagaa gattgggaaa
     1081 atgttgtcat ctgctgcatc caccttgaga gcttgcaaag accttggtgc atatgggcta
     1141 gagatcttaa agttagtcat gaagtggttc ttcccgaaga aagaggaagc gaatgaactg
     1201 gccatggtga gatccatcga ggatgcagta ctggaccttg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagatagc ctggcaacct acatgagaac cctcgacctc
     1321 gaggaagaga aagccagaaa actctcaacc aagtctgctt cacctgacat cgtgggcaca
     1381 atcaacgcac ttctggcgag aatcgccgct gcacgctccc tggtgcaccg agcaaaggag
     1441 gagctttcca gcagaccaag acctgtagtc ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc ttgctaggga agtggctaag agaatcgcag cctccctcac aggagaccag
     1561 cgtgtaggcc tcatcccacg caatggtgtc gatcactggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgacta tggaatgagc aaccccatcc acgacgctct caggctgcaa
     1681 gaactcgctg acacttgccc cctcactcta aattgtgaca ggattgagaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcact actaacctgg ccaacccagc accactggac
     1801 tatgtcaact ttgaggcatg ctcgagacgc atcgatttcc tcgtgtacgc agaagccccc
     1861 gaggtcgaaa aggcgaagcg agacttcccg ggccaacctg acatgtggaa aaacgctttt
     1921 agccctgatt tctcacacat aaaattggca ctggctccac aaggtggctt tgataagaac
     1981 gggaacaccc cacatggaaa gggtgtcatg aagactctca ccactggctc cctcattgcc
     2041 cgggcatcag ggctgctcca tgagagattg gatgagttcg aactacaggg tccaactctt
     2101 accaccttca actttgaccg caacaaagtg cttgccttca ggcagcttgc tgctgaaaac
     2161 aaatatggat tgatggacac aatgaaagtt gggaggcagc tcaaggatgt caaaaccatg
     2221 ccagaactca agcaagcact caagaatatc tcaatcaaga agtgccagat tgtgtacagt
     2281 ggttgcacct acacacttga gtctgatggc aagggtaatg tgaaagttga cagagtacag
     2341 agtacctccg ttcagaccaa caatgagctg gctggcgcct tgcaccatct aaggtgcgcc
     2401 agaatcaggt attatgttaa gtgtgttcag gaggccctgt attctatcat ccagattgct
     2461 ggggctgcat ttgtcaccac gcgcatcatc aagcgtgtga acattcaaga cttatggtcc
     2521 aagccacaag tggaaaacac agaggaggct accagcaagg acgggtgccc aaaacccaaa
     2581 gatgatgagg agttcgtcat ttcatctgac gacattaaaa ctgagggtaa gaaagggaag
     2641 aacaagactg gccgtggcaa gaagcacaca gccttctcaa gtaaaggtct cagtgatgaa
     2701 gagtatgatg agtacaagag aattagagag gaaagaaatg gcaagtactc catagaagag
     2761 tatcttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gaccgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttagacc aacaaggaag
     2881 caacgcaagg aagaaagagc ttctctcggt ttagtcacag gttctgaaat taggaaaaga
     2941 aacccagaag acttcaagcc caaggggaaa ctatgggctg acgatgacag aagtgtggac
     3001 tataatgaaa aacttagttt tgaggcccca ccaagcatct ggtcaaggat agtcaacttt
     3061 ggctcaggtt ggggcttctg ggtctccccc agcctgttca taacatcaac ccacgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaattcaggt gcacaagtca
     3181 ggcgagttct gtcgcttgag gttcccaaag ccaatcagga ccgatgtggc tggcatgatt
     3241 ttggaagaag gtgcgcccga aggcaccgtg gtctcactac tcatcaaaag gtctactgga
     3301 gaactcatgc ccctagcagc tagaatggga acccacgcaa ccatgaaaat tcaaggtcgc
     3361 actgttggag gtcagatggg catgcttctg acaggttcca acgccaaaag catggatcta
     3421 ggcaccacgc caggcgattg cggctgtccc tacatctaca agagaggaaa cgactatgtg
     3481 gtcattggag tccacacggc tgccgctcgt gggggaaaca ctgtcatatg tgccacccag
     3541 gggggtgagg gggaagctac acttgaaggt ggtgacagta agggaacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaaa ctcagcacca aaaccaaatt ctggaggtca
     3661 tccacagcac cactcccacc tggcacctat gaaccagcct accttggtgg caaggacccc
     3721 agagtcaagg gtggcccctc gctgcagcaa gtcatgaggg accagctgaa accatttaca
     3781 gagcctaggg gtaagccacc aaagccaagt gtgttagaag ctgccaagaa aaccatcatc
     3841 aatgtccttg aacagacaat tgatccacct gagaagtggt cgttcgcaca agcttgcgcg
     3901 tcccttgata agaccacttc tagcggccat ccgcaccaca tgcggaaaaa tgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaagccaa cctgatgttt
     4021 gaagaaggga aaaacatgac cccggtctac acaggtgcac tcaaggatga attagtcaaa
     4081 actgacaaaa tttatggcaa gatcaagaag aggcttctct ggggctcgga cctggcaacc
     4141 atgatccggt gtgctcgagc attcggaggt ctgatggatg agctcaaagc acactgtgtc
     4201 acacttcctg tcagagttgg tatgaatatg aatgaggatg gccccatcat cttcgagaag
     4261 cattccaggt acagatacca ttatgatgct gattactctc ggtgggattc aacacaacag
     4321 agagccgtgc tggcagctgc tctagaaatc atggttaaat tctcctcaga accacatttg
     4381 gctcaggtag tagcagagga ccttctttct cctagcgtag tggatgtggg tgacttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctctcaatg gaactccatc
     4501 gctcactggc ttctcactct ttgtgcgctc tccgaagtca caaatttgtc tccagacatc
     4561 atacaggcta attctctctt ctccttctat ggtgatgatg aaattgtcag cacagacata
     4621 aaattagacc cagaaaaatt gacagcaaag cttaaggaat atgggttgaa accaacccgc
     4681 cctgataaaa ctgaagggcc tcttgttatt tctgaagact tagatggttt gactttcctg
     4741 cggagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagctcaata
     4801 ctcaggcaaa tgtactggac caggggcccc aaccatgaag acccatctga atcaatgatc
     4861 ccacactctc aaagacccat acaattgatg tccttactgg gagaggccgc actccacggc
     4921 ccaacattct acagtaaaat cagcaaatta gtcattgcag agcttaaaga aggtggcatg
     4981 gatttttacg tgcccaggca agagccaatg ttcagatgga tgagattctc ggatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgaatga
     5101 cgccaaccca tctgatgggt ccgcagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgttgttg gtgccgctat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa ataattttgt acaagcccct ggtggagagt tcacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atctaaaccc
     5341 ctacctatct catttggcca gaatgtataa tggttatgca ggtggttttg aagtgcaggt
     5401 gatcctcgcg gggaacgcgt tcaccgccgg aaaaattata tttgcagcag tcccaccaaa
     5461 ttttccaact gaaggcttga gtcccagcca ggtcactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cttacctgat gttaggaata atttctatca
     5581 ttataatcag tcaaatgatt ctaccattaa attgatagca atgctgtata caccacttag
     5641 ggctaataat gctggggatg atgtctttac agtttcttgt cgagttctca cgagaccatc
     5701 ccccgatttt gatttcatat ttttagtgcc acctacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtccca attttaactg ttgaagaaat gaccaattca aggttcccca ttcctttgga
     5821 aaagttgttc acgggcccca gtagtacctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtaccaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccacattg caggcagtcg taactacaca atgaacctgg cttcccaaaa
     6001 ttggaacagt tatgacccaa cagaagaaat cccagcccct ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcactcaaac cacaaggaca gatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggta gagttcaatt
     6181 tgccactgac acagacaatg atttcgatgc taaccaaaac actaagttca ccccagtcgg
     6241 tgttatccag gatggtggca ctgcccaccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggc agaaacactc ataatgtgca cctggccccc gctgtagccc ccacttttcc
     6361 gggtgagcaa ctcctcttct tcagatctac catgccagga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtat ttctaccagg aagcagcccc
     6481 agcacaatct gatgtggctc tgctaagatt tgtgaatcca gacacaggta gggttctgtt
     6541 tgagtgtaag cttcataaac caggctatgt tacagtggct cacactggtc aacatgattt
     6601 ggttatcccc cccaatggtt attttagatt tgattcctgg gtcaaccagt tctacacact
     6661 tgcccctatg ggaaatggga cggggcgtag acgtgcatta taatggctgg agctttcttt
     6721 gctggattgg catctgacgt cctcggctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggccatca accaaaaagt tgaatttgaa aataacagaa aattgcaaca agcttccttc
     6841 caatttagca gcaatctaca acaggcttcc tttcaacatg ataaagagat gctccaatca
     6901 caaattgatg ccaccaaaaa gttgcaacag gaaatgatga gagttaaaca agcaatgctc
     6961 ctagagggtg ggttctctga gacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaagttttgg actggagcgg gacaaggtac tgggctcccg atgctaggac tacaacatat
     7081 aatgcaggcc gcttttccac ccctcaaccc tcgggggcac cacctggaag agctaatctt
     7141 agggctgctg tccccgcccg gggttcctcc agcacatctt ctaactcttc tattgctact
     7201 tctatgtatt caaatcaaac cacttcaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gcctcccgtc atctgcaagg actaggagct gggttgagga tcaaaatagg
     7321 aatttgtcac ctttcatgag gggggcccac aacatctcgt ttgtcacccc accatctagc
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca atacgcgcag gcagcctctc ttcgctcaca tccgtaggcg aggggagtca
     7501 cgggtgtaa