Typing tool

Complete norovirus genomes

KF429768  GII.4 New Orleans
 GII.P4 Hunter

Length: 7,503 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6697
ORF3: 6697..7503
LOCUS       KF429768                7503 bp ss-RNA     linear   VRL 24-OCT-2013
DEFINITION  Norovirus Hu/GII.4/NIHIC1.13/2012/USA, complete sequence.
VERSION     KF429768.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII.4/NIHIC1.13/2012/USA
  ORGANISM  Norovirus Hu/GII.4/NIHIC1.13/2012/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7503)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (28-JUN-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 984.1x
            Sequencing Technology    :: Sanger; Illumina
FEATURES             Location/Qualifiers
     source          1..7503
                     /organism="Norovirus Hu/GII.4/NIHIC1.13/2012/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 12_Forward, fwd_seq:
                     cagtytcttgtcgrgtyctca, rev_name: 12_Reverse, rev_seq:
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..13
     gene            5081..6697
     CDS             5081..6697
                     /product="capsid protein VP1"
     gene            6697..7503
     CDS             6697..7503
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctgacagcaa caacgacacc
       61 gttaaatctt caagtgacgg agtgctttct agcatggctg tcactttcaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaataccac aaagaccccc gcgaccaccc
      181 actccagaac tgatcaaaaa tatcccccct cccccaccca atggagagga tgatgtagtg
      241 gtttcttata gcgtcaaaga tggtatctct ggtttacctg atctttccac cgtcaggcaa
      301 ccggaagaat ctaatacggc cttcagtatc cctccactca atcagaggga gagtagagaa
      361 gctaaggaac cactgactgg aacaattttg gaaatgtggg atggagaaat ctatcattat
      421 ggcctgtacg tagagcgagg tcttgtacta ggtgtgcaca aaccaccagc tgccatcagt
      481 ctcgctaggg tcgaactaac accactttcc ttgtactgga gacctgtgta cactccccag
      541 tacctcatct ctccagacgc tctcaagaga ctacacggag agacgttccc ctacacagcc
      601 tttgacaaca actgctatgc cttttgttgt tgggtcctgg acctaaacga ctcgtggctg
      661 agtaggagaa tgatccagag aacaactggc ttcttcagac cctaccaaga ttggaatagg
      721 aaacccctcc ccactatgga tgactccaaa ttaaagaagg tggctaacat attcctgtgt
      781 gcattgtctt cgctattcac caggcctata aaagatataa tagggaagct aaggcctctt
      841 aacatcctta acatcttggc ttcatgtgat tggtcttttg caggcatagt ggagtccttg
      901 atactcttgg cagaactctt tggagttttc tggacgcccc cagatgtgtc tgcgatgatt
      961 gcccccttac tcggtgacta cgaactgcag ggacctgagg accttgcagt ggagctcgtc
     1021 cctgtagtga tggggggaat tggtttggtg ctaggattca ccaaagagaa gattggaaaa
     1081 atgttgtcat ctgctgcatc caccctgaga gcttgtaaag atcttggtgc atatgggcta
     1141 gagatcctaa agttggctgt gaagtggttc ttcccgaaga aagaggaagc aaatgaactg
     1201 gctatagtga gatccatcga ggatgcagtc ctggatctcg aagcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaaagcagt ctggcagcct acatgaaaac ccttgacctt
     1321 gaggaggaga aagccaggaa actctcaacc aagtctgctt cacctgacat tgtgggcaca
     1381 gtcaacgccc ttctggcgag aatcgctgct gcacgttctc tggtgcatcg agcgaaggag
     1441 gaactttcta gcagaccaag acctgtagtg ttgatgatat caggcagacc aggaataggg
     1501 aagacctacc ttgccagaga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtaggcc tcgtcccacg caatggcgtc gaccactggg atgcgtacaa gggggagagg
     1621 gtcgttctat gggatgacta tggaatgagc aatcccatcc aagatgccct cagattgcaa
     1681 gaactcgctg acacttgtcc cctcaccctg aactgtgaca ggattgagaa caaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcacc actaacctgg ctaacccagc accactggac
     1801 tatgtcaact tcgaagcatg ctcgaggcgc atcgacttcc tcgcgtatgc agaagcccct
     1861 gaggtcgaaa aggcgaagcg tgacttccca ggccaacccg atatgtggaa gaacgccttc
     1921 agtcctgatt tcacacacat aaaactaaca ttggctccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacgggaa gggcgtcatg aagactctca ccaccggctc cctcattgcc
     2041 cgggcatcag ggctactcca tgagaggcta gatgaatttg aactacaggg cccaactctc
     2101 accactttca actttgaccg caataaagtg cttgccttta gacaacttgc tgctgaaaac
     2161 aaatatgggt tgatggacac aatgaaagtt gggaggcagc tcaaggatgt cagaacaatg
     2221 ccagagctca agcaagcact caagaatatt tcaatcaaga agtgccagat agtgtacagt
     2281 ggtagcacct acacacttga gtctgatggc aagggtaatg tgaaggttga cagagtccaa
     2341 agcgcctccg tgcagaccaa caatgagctg gctggcgccc tacaccatct aaggacagcc
     2401 agaatgagat actatgtcag gtgtgtccag gaggccctgt attccatcat ccagattgct
     2461 ggggctgcat ttgtcaccac gcgcatcgtc aagcgcatga acatacaaag cctatggtct
     2521 aaaccacaag tggaaaacac agaggagact accagcaggg acgggtgtcc aaaacccaaa
     2581 gatgatgagg agttcgtcat ttcatccgac gacatcaaga ctgaaggcaa gaaagggaaa
     2641 aacaagactg gccgcggtaa gaagcacaca gccttctcaa gcaaaggtct cagtgatgaa
     2701 gagtacgatg agtacaagag gattagagaa gaaaggaatg gtaagtactc catagaagag
     2761 taccttcaag acagggacaa atactatgag gaggtggcca ttgccagggc gaccgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tcttcaggcc aacaaggaaa
     2881 caacgcaagg aggaaagagc ttctctcggt ttagtcacag gttctgaaat taggaaaaga
     2941 aatccagatg atttcaaacc caaggggaaa ttgtgggctg acgatgacag aagtgtggac
     3001 tacaatgaga aactcagttt tgaagcccca ccaagcatct ggtcgaggat agtcaacttt
     3061 ggttcaggtt ggggattctg ggtttccccc agtttgttca taacatcaac ccatgtcata
     3121 ccccagggag caaaggagtt ctttggagtc cccatcaaac aaattcaggt acataagtca
     3181 ggcgaattct gtcgcttgag attcccaaaa ccaatcaggg ctgatgtgac gggcatgatc
     3241 ttagaagaag gtgcacccga gggcaccgtg gttacactac tcatcaaaag gtccactggg
     3301 gaactcatgc ccctagcagc taggatgggg acccatgcaa ccatgaaaat ccaaggacgc
     3361 actgttggag gtcaaatggg catgcttctg acaggatcca acgccaaaag catggacctg
     3421 ggtaccacac caggtgattg tggctgtccc tacatctaca agagaggaaa tgactatgta
     3481 gtcattggag tccacacggc tgccgctcgt gggggcaaca ctgtcatctg tgccacccag
     3541 gggagtgagg gagaggctac acttgaaggt ggtgacaaca aagggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaaa cttagcacca agaccaaatt ctggagatcg
     3661 tccacagcac cactcccacc tggcacctat gaaccagcct atcttggtgg tagggatccc
     3721 agagtcaagg gtgggccttc actacagcag gtcatgaggg atcagctgaa gccattcaca
     3781 gagcccaggg gcaagccacc aaagccaagt gtgttggaag ctgctaagaa aaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcacttgata agaccacctc cagtggtcac ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagagggga agaacatgac gccagtctat acagctgcgc ttaaggatga attagttaaa
     4081 actgacaaga tttatggtaa gatcaagaaa aggcttctct ggggctcgga tttggcgacc
     4141 atgatccggt gtgctcgagc attcggaggc ctaatggatg aactcaaagc gcactgtgtc
     4201 acacttccca tcagagttgg tatgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cactccaggt acacgtacca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agagccgtgt tggcagcagc tctagaaatt atggttaagt tctccccaga accacatttg
     4381 gcccaggtag tcgcagaaga ccttctttcc cctagcgtgg tggacgtggg tgactttaca
     4441 atatcaatta acgagggtct tccctctgga gtgccctgca cctcccaatg gaactccata
     4501 gcccactggc ttctcaccct ctgtgcgctc tctgaagtta caaacttgtc tcctgacacc
     4561 atacaagcta attccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagaaaagtt gacagcaaag ctcagggaat atgggttaaa accaacccgc
     4681 cccgacaaaa ctgaaggacc ccttgccatc tctgaagact tggatggcct gactttcttg
     4741 cgaagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagctcaata
     4801 ctcaggcaaa tgtactggac taggggttcc aaccatgaag acccatctga aacaatgatt
     4861 ccacactccc aaaggcccat acaactgatg tccctactgg gggaggccgc actccacggc
     4921 ccaacattct acagcaaaat cagcaagtta gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggccaaca atgaggttat
     5161 ggctttggag cccgttgttg gtgccgccat tgcggcgcct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa acaattttgt gcaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccaggtg aagtactatg gagcgcgccc ttaggccctg atttgaatcc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aatcctcgcg gggaacgcgt tcgccgccgg aaaaatcata ttcgcagcag tcccaccaaa
     5461 tttctcaact gaaggcttga gccccagcca ggtcactatg ttcccccact taatagtaga
     5521 tgttaggcaa ctggaacctg tgatgatccc cttacccgat attaggaata atttctatca
     5581 ttacaatcaa tcaaatgatc ccaccatcaa attgatagca atgttgtata cacctcttag
     5641 ggctaataat gttggtgacg atgtcttcac agtttcttgt cgggtactca cgagaccatc
     5701 ccccgatttt gatttcatat ttctagtgcc acccacagtt gaatcaaaaa ccaacccatt
     5761 ctctgttcca attctaacta ttgaggagat gaccaattca agattcccca ttcctttgga
     5821 aaagttgttc acgggcccca gcagtgccct tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctgg gtaccaccca actgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccatacta caaaaactca tacctaccaa atgaatttgg ctgctcaaaa
     6001 ttggaacagt tatgacccaa cagaagaaac cccagccccc ctaggaactc cagatttcgt
     6061 gggaaagatc caaggtgtgc tcacccaaac cacgaaggga aatggctcaa cccgtgccca
     6121 caaagctaca gtgtacactg ggaccgtcga gttcactcca aaactgggta gaatccaact
     6181 tttcactgac acagacaacg atcttgaagc taaccaaaac acaaagttca ccccagtcgg
     6241 tgtcatccag gatggtgacc accaaaatga accccaacaa tgggtactcc caagttactc
     6301 aggtagaaat aatcacaatg tgcacctggc ccccgctgta gcccccactt ttccgggcga
     6361 gcaacttctc ttcttcagat ccactatgcc cggatgcagc gggtacccca acatgaattt
     6421 ggactgtctg cttccccagg aatgggtgca atatttctat caagaggcag ccccagcaca
     6481 atctgatgtg gctttgctaa gatttgtgaa tccagataca ggtagggttt tgtttgagtg
     6541 caagcttcat aaatcaggtt atgtcacagt ggcccacacc ggccaccatg atttggttat
     6601 cccccctaat ggttatttca gatttgattc ctgggtcagc cccttctaca cgcttgcccc
     6661 catgggaaat ggaacggggc gtagacgtgc attataatgg ctggagcttt ctttgctgga
     6721 ttggcatctg acgtccttgg atccggactt ggttctctga tcaatgccgg ggctggggcc
     6781 atcaaccaaa aagttgaatt tgaaaacaac agaaaattgc aacaagattc cttccaattt
     6841 agtagcaatc tgcaacaggc ttcctttcaa catgataaag agatgctcca agcacaaatt
     6901 gaggccacca aaaagttgca acaggaaatg atgagagtta aacaggcaat gctcctagag
     6961 ggtgggttct ctgagacaga tgcagcccgt ggggcaatca acgcccccat gacaaaggtt
     7021 ttggactgga gtgggacaag gtactgggct cccggtgcta ggactacaac atacaatgca
     7081 ggctactttt ccactcccca acactcgggg gcactgccag gaagagctaa tcttagggct
     7141 gttgtccccg ctcggggctc ctctagagta tcttctaatt cttctactgc tacctctgtg
     7201 tattcaaatc aaactgcttc aacgagactt ggttctacag ctggttctgg taccagtgtc
     7261 tcgagcctcc cgtcaactgc aaggactagg agttgggttg aggatcaaaa taggaatttg
     7321 tcacctttca tgaggggggc ccacaacata tcgtttgtca ccccaccatc tagcagatcc
     7381 tctagtcaag gcacagtctc aaccgtgccc aaagaagttt tgaactccca ggctggcgtt
     7441 ttcaatacgc gcaggcagcc tctctttgct cacattcgta ggcgagggga gtcacgggcg
     7501 taa