Typing tool

Complete norovirus genomes

KF429760  GII.4 Farmington Hills
 GII.P4 New Orleans

Length: 7,506 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6700
ORF3: 6700..7506
LOCUS       KF429760                7506 bp ss-RNA     linear   VRL 24-OCT-2013
DEFINITION  Norovirus Hu/GII.4/NIHIC28.4/2012/USA, complete sequence.
VERSION     KF429760.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII.4/NIHIC28.4/2012/USA
  ORGANISM  Norovirus Hu/GII.4/NIHIC28.4/2012/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7506)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (28-JUN-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 2413.5x
            Sequencing Technology    :: Illumina
FEATURES             Location/Qualifiers
     source          1..7506
                     /organism="Norovirus Hu/GII.4/NIHIC28.4/2012/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: 1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: 4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: 5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: 6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: 7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 8_Forward, fwd_seq:
                     ygactcgtggctgagyagga, rev_name: 8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 9_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: 9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: 10_Forward, fwd_seq:
                     gggaaraacaagrctggycg, rev_name: 10_Reverse, rev_seq:
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..13
     gene            5081..6700
     CDS             5081..6700
                     /product="capsid protein VP1"
     gene            6700..7506
     CDS             6700..7506
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caagtgacgg agtgttttct aacatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaataccac aaagaccccc acgaccacct
      181 actccagagc tggtcaaaaa tatcccccct cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgttaagga tggcgtttcc ggcttgcctg atctttccac cgtcagacaa
      301 ccggaagaat ccaacacggc cttcagtgtc cctccactca gtcagaggga gaacagagac
      361 gctaaggagc cactgactgg aactattctg gaaatgtggg atggagagat ctatcattat
      421 ggtctgtatg tggagcgagg tctcatatta ggtgtgcaca aaccaccagc cgccattagc
      481 ctcgccagaa tagaactaac accactctcc ttgttctgga ggcctgtgta tactcctcag
      541 tacctcatct ctccagatac tctcaggaaa ttgcacggag agacgttccc ctacacagcc
      601 tttgacaaca attgctatgc cttttgctgc tgggtcctgg acctaaacga ctcgtggctg
      661 agtaggagaa tgatccaaag aacaactggc ttcttcagac cctaccagga ttggaatagg
      721 aaacccctcc ccactatgga tgactccaag ttaaagaagg tagctaacat actcctgtgt
      781 gcactgtctt cgctattcac caggcccata aaagatttaa tagggaagct aaggcccctt
      841 aacatcctca acatcttggc ctcatgtgat tggactttcg caggcatagt ggaatccttg
      901 atactcttgg gagaactctt tgatattttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac tcggtgacta cgagctacaa ggacctgagg accttgcagt ggagctcgtc
     1021 cctgtagtaa tggggggaat tggtctggtg ctaggattca ccaaagagaa gatcgggaaa
     1081 atgttgtcat ctgctgcaac caccttgaga gcttgtaaag atcttggtgc atatgggtta
     1141 gagatcctaa agttggtcat gaagtggttc ttcccgaaga aagaggaggc aaatgagctg
     1201 gctatagtga gatccattga ggacgcagtt ctggatctcg aggcaattga gaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagt ctggcagtct acatgagaac ccttgacctt
     1321 gaggaggaga aagccaggaa gctctcaacc aagtctgcct cacctgacat cgtgggcaca
     1381 atcaacgccc ttctggcgag aatcgctgca gcacgctctc tggtgcaccg agcaaaggag
     1441 gagctctcca gcagaccaag acctgtggtg atgatgttgt caggcagacc aggaataggg
     1501 aagacccacc ttgctaggga agtggctaag agaattgcag cctcccttac aggagatcag
     1561 cgtgtgggcc tcatcccacg caacggcgtc gaccactggg attcgtacag gggggagagg
     1621 atcgtccttt gggacgacta tggaatgagc aatcccatcc acgatgccct cagactgcaa
     1681 gaactcgctg acacctgccc cctcacccta aattgtgata ggattgagaa taaaggaaag
     1741 gtctttgaca gcgatgtcat tatcatcacc actaacctgg ctaacccagc accactggac
     1801 tatgtcaact ttgaagcatg ttcgaggcgc attgacttcc tcgtgtatgc agaagcccct
     1861 gaggtcgaaa aggcgaaacg cgacttccca ggccaacccg acatgtggaa gaacgccttc
     1921 agctctgact tctcacacat aaaactgaca ctggctccac agggtggctt cgacaagaac
     1981 ggaaacaccc cacacggaaa gggcgtcatg aagactctca ccattggctc ccttattgcc
     2041 agggcatcag ggctactcca tgagaggcta gatgaatttg aattacaggg cccaaccctc
     2101 accaccttca actttgatcg caacaaagtg cttgccttta gacaacttgc tgcagaaaac
     2161 aaatatgggt taatggaaac aatgaaagtc gggagacagc tcaaggacgt caggacaatg
     2221 ccagagctta aacaagcact caagaatatc tcaatcaaga ggtgccaaat agtatacaat
     2281 ggtagtacct acacacttga gtccgatggc aagggcagtg tgaaagttga cagagttcag
     2341 agtgcctccg tgcagaccaa caatgagctg gctggcgcac tgcaccatct aagaagcgcc
     2401 agaataagat actatgttaa gtgtgtccag gaggccctgt attccataat ccagattgct
     2461 ggggctgcat ttgtcaccac gcgcattgtc aagcgcatga acatacaaaa cctatggtcc
     2521 aaaccacaag tggaaaacac agaggagact accaacaagg atgggtgccc aaaacccaaa
     2581 gatgatgagg agttcgtcat ttcatccgac gacatcaaaa ctgaaggtaa gaaagggaag
     2641 aacaagactg gccgcggcaa gaagcacaca gccttctcaa gcaaaggtct cagtgatgaa
     2701 gagtacgatg agtacaagag gatcagagaa gaaaggaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcta ttgccagagc gaccgaggag
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttagacc aacaaggaaa
     2881 caacgcaagg aggaaagagc ttctctcggc ctagtcacag gttctgagat taggaaaaga
     2941 aacccagatg acttcaagcc caaagggaaa ctgtgggctg acgatgacag aagtgtggac
     3001 tacaatgaga aactcagttt tgaagccccc ccaagcatct ggtcgaggat agtcaacttt
     3061 ggttcaggtt gggggttctg ggtctccccc agtctgttca taacatcaac ccatgtcata
     3121 ccccagggcg caaaggaatt ctttggggtc tctgtcaagc aaattcaggt acataaatca
     3181 ggtgaatttt gccgcttgag gttcccaaaa ccaatcagaa ctgatgtgac gggcatgatc
     3241 ttagaagaag gtgcacccga gggcaccgtg gtcacactac ttattaaaag atccactggt
     3301 gaactcatgc ccctagcagc caggatggga acccatgcaa ccatgaaaat tcaagggcgc
     3361 actgtcgggg gtcaaatggg catgcttctg acaggatcca acgccaaaag tatggacctg
     3421 ggtaccacac caggtgattg tggctgcccc tacatctaca agagaggaaa tgactatgtg
     3481 gttataggag tccacacggc tgccgctcgt gggggaaaca ctgtcatatg tgccacccag
     3541 gggagtgagg gagaagctac actcgagggt ggtgacaata aaggaacata ctgtggtgca
     3601 ccaatcctag gcccagggaa tgccccaaag ctcagtacta agaccaaatt ctggagatcg
     3661 tccacagcac cactcccacc tggtacctat gaaccagcct accttggtgg caaggacccc
     3721 agagtcaagg gtggcccttc actgcagcaa gtcatgaggg atcagctgaa gccatttaca
     3781 gagcccagag gcaaaccacc aaagccaagt gtgttggaag ctgccaagaa aaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt catttgcaca agcttgcgcg
     3901 tcccttgaca aaaccacttc cagtggccat ccacaccaca tgcggaaaaa cgactgctgg
     3961 aacggagagt ccttcacagg caagctggcg gaccaagctt ccaaggccaa cctgatgttt
     4021 gaagaaggga aaagcatgac cccaatctac acagctgcac ttaaggatga attagttaag
     4081 actgacaaaa tttatggtaa gatcaagaag aggcttctct ggggctcgga tctagcaacc
     4141 atgattcgat gtgctcgagc attcggaggc ctaatggatg aactcaaagc gcactgtgtc
     4201 acacttccca ttagagttgg tatgaatatg aatgaggatg gccccatcat cttcgagaaa
     4261 cattccaggt atacatacca ctatgatgct gattactctc gatgggattc tacacaacag
     4321 aggggcgtgt tggcagcagc tctagagatc atggttaaat tctccccaga accacatttg
     4381 gctcaggtag tcgcagagga cctcctttct cctagcgtgg tggacgtggg tgacttcaca
     4441 atatcaatca acgagggcct tccttctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc tcctcactct ctgtgcgctc tctgaagtta caaatttgtc tcctgacacc
     4561 atacaggcta attccctctt ctctttctat ggtgatgatg aaattgtcag cacagatata
     4621 aaattggacc cggaaaaatt gacagcaaag ctcagggaat atgggctgaa gccaacacgc
     4681 cctgacaaaa ccgaaggacc ccttgtcatc tctgaagact tggatggcct gaccttcctg
     4741 cggaggactg tgacccgcga cccagcaggt tggtttggga aactggagca gagctcaata
     4801 ctcaggcaaa tgtactggac taggggttcc aaccatgaag atccatctga aacaatgatt
     4861 ccacactccc aaagacccat acaattgatg tccctactgg gggaggccgc acttcatggc
     4921 ccagcatttt acagcaaaat cagcaaatta gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgaatga
     5101 cgctacccca tctgatgggt cctcggccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttagaa cccgttgctg gcgccgcgat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa ataattttgt acaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgtcc ttgggccctg atttgaaccc
     5341 ctacctttcc cacttgtcta gaatgtataa tggttatgca ggtagttttg aagtgcaggt
     5401 aatcctcgcg gggaacgcgt tcaccgctgg gaaaatcata tttgcagcag tcccaccaaa
     5461 tttccgaact gaaggcttga gccccagcca gatcaccatg ttcccccaca taataacaga
     5521 tgttagacaa ttggaacctg tgttgatccc cttgcctgat attaggaata atttctacca
     5581 ttataatcaa tcaaatgacc ccactattaa attgatagca atgctgtata caccacttag
     5641 ggccaataat gctggggatg atgttttcac agtctcttgc cgagttctca caaggccatc
     5701 ccccgatttt gatttcatat ttctggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtccca gtcctaactg ttgaggagat gaccaactca agattcccta ttcctttgga
     5821 aaagttgttc acgggcccta gcagtgcctt tgttgttcag ccacaaaatg gtagatgcac
     5881 gaccgatggc gtgctcttag gtaccaccca actgtctcct gtcaacatct gcaccttcag
     5941 gggggatgtc acccgcattg gaaattctcg cgagtacaga atgaacctgg cctccctaaa
     6001 ttggaacaat tatgacccaa cagaagaaat cccagccccc ctgggaaccc cagattttgc
     6061 aggtaagatc caaggtgtgc tcacccagac cacaaggcat gatggctcga cccgcggtca
     6121 caaagccacg gtgtacactg gaagtgccgg attcacccca aagctaggca gtgttcaatt
     6181 ctccactgac acagacaatg accttgaggc caaccaaaac acgaggttca ccccagtcgg
     6241 tgtcatccag gacggcaacg cccaccaagg agaacctcag caatgggtgc tcccaaacta
     6301 tgcaggcaga gatggtcaca atgtacacct agcccctgcc gtggccccca ctttcccggg
     6361 tgagcaactt ctcttcttta ggtccaccat gcccgggtgt agcgggtatc ccaatatgaa
     6421 tttggactgc ctactccccc aggagtgggt gcagcacttc taccaagagt cagccccagc
     6481 acaatccgat gtggcattac ttagatttgt gaatccagac acaggtaggg ttttgtttga
     6541 gtgcaaactt cataaatcag gctacgtgac agtggctcac actggcccac atgatttggt
     6601 tatccccccc aatggctatt ttagatttga ttcctgggtc aaccagttct acacacttgc
     6661 ccccatggga aatggagcgg ggcgtaggcg tgcattataa tggctggagc tatcattgct
     6721 ggattggcat ctgatgtcct tagctctgga cttggttccc taatcaatgc tggggctggg
     6781 gtcatcaacc aaaaagtcga ttttgaaaat aataaacaac tgcaacaaaa ctccttccaa
     6841 tttagcagca atctacaaca ggcttccttt caacatgata aagagatgct ccaagcacaa
     6901 attgaggcca ccaaaaagtt gcaacaggaa atgatgggaa tcaaacaggc agtactccta
     6961 aagggtgggt tctctgagac agatgcagcc cgtggggcag tcaacgcccc catgacaaag
     7021 gttttggact ggagtggaac aaggtactgg gctcccaatg ctagcaccac aacatacaat
     7081 gcaggccgct tttccacccc ccagccctcg ggggcgttgc caggaagaac taatctcagg
     7141 actgctgccc ccgctcgggg ctcccccagc atatcttcta atgcttctac tgctacttct
     7201 gtctattcaa atcaaactgt ttcaacgaga cttggtactt cagctggttc tggtaccagt
     7261 gtctcgagcc tcccgtcaac tgcgaggact aggagctggg ttgaggatca aaacaggaat
     7321 ttgtcacctt tcatgagagg ggctcacaac atatcgtttg ttaccccacc atctagcaga
     7381 tcctctagcc aaggcacagt ctcaaccgtg cctaaagaag ttttggactc ctggactggc
     7441 gccttcaaca cgcgcaggca gcctctcttc gctcacattc gtaagcgagg ggagtcacgg
     7501 gtataa