Typing tool

Complete norovirus genomes

KF039736  GI.1

Length: 7,600 | 3 CDS

ORF1: 1..5370
ORF2: 5354..6946
ORF3: 6946..7584
LOCUS       KF039736                7600 bp ss-RNA     linear   VRL 24-OCT-2013
DEFINITION  Norovirus Hu/GI.1/CHA7A011/2010/USA, complete genome.
VERSION     KF039736.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GI.1/CHA7A011/2010/USA
  ORGANISM  Norovirus Hu/GI.1/CHA7A011/2010/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7600)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (10-MAY-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 514.5x
            Sequencing Technology    :: Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7600
                     /organism="Norovirus Hu/GI.1/CHA7A011/2010/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /lab_host="Pan troglodytes"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     tgtaaaacgacggccagtgaatgatgatggcgtcaa, rev_name:
                     Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     tgtaaaacgacggccagtcacaattggtgacatgatcg, rev_name:
                     Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tgtaaaacgacggccagttcggtcaatatggcctagaa, rev_name:
                     Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     tgtaaaacgacggccagtcggtggtgatcaaacagag, rev_name:
                     Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tgtaaaacgacggccagtgaataccccgtttggtaagg, rev_name:
                     Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     tgtaaaacgacggccagtgacgtggtcgcaaaaataac, rev_name:
                     Ampl_6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_7_Forward, fwd_seq:
                     tgtaaaacgacggccagttcagagaagaaaagaatggca, rev_name:
                     Ampl_7_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_8_Forward, fwd_seq:
                     tgtaaaacgacggccagtttgacaggtatggtccttgaaga, rev_name:
                     Ampl_8_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_9_Forward, fwd_seq:
                     tgtaaaacgacggccagtactataccaggagactgc, rev_name:
                     Ampl_9_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_10_Forward, fwd_seq:
                     tgtaaaacgacggccagtcaccgtggtctgcgctgta, rev_name:
                     Ampl_10_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_11_Forward, fwd_seq:
                     tgtaaaacgacggccagtacccccgtgtacagaatggc, rev_name:
                     Ampl_11_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_12_Forward, fwd_seq:
                     tgtaaaacgacggccagtaccataaaaggaagaatg, rev_name:
                     Ampl_12_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_13_Forward, fwd_seq:
                     tgtaaaacgacggccagtgcacacgccaacaatatgta, rev_name:
                     Ampl_13_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_14_Forward, fwd_seq:
                     tgtaaaacgacggccagtcactgcagccttaaaagatga, rev_name:
                     Ampl_14_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_15_Forward, fwd_seq:
                     tgtaaaacgacggccagtccaatcattcagatccatca, rev_name:
                     Ampl_15_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_16_Forward, fwd_seq:
                     tgtaaaacgacggccagttgcctttggaagatgttagg, rev_name:
                     Ampl_16_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_17_Forward, fwd_seq:
                     tgtaaaacgacggccagtatccccaattatgggtcaag, rev_name:
                     Ampl_17_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_18_Forward, fwd_seq:
                     tgtaaaacgacggccagttagccccttctgtatacccc, rev_name:
                     Ampl_18_Reverse, rev_seq:
                     /note="Chimpanzee passage of Norovirus
                     genotype: GI.1"
     gene            1..5370
     CDS             1..5370
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..1194
                     /product="protein p37"
     mat_peptide     1195..2283
     mat_peptide     2284..2886
                     /product="protein p20"
     mat_peptide     2887..3300
                     /product="viral genome-linked protein"
     mat_peptide     3301..3843
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3844..5367
                     /product="RNA-directed RNA polymerase"
     primer_bind     1..16
     gene            5354..6946
     CDS             5354..6946
                     /product="capsid protein VP1"
     gene            6946..7584
     CDS             6946..7584
                     /note="minor capsid protein; basic protein"
                     /product="capsid protein VP2"
        1 atgatgatgg cgtcaaaaga cgtcgttcct actgctgcta gcagtgaaaa tgctaacaac
       61 aatagtagta ttaagtctcg tctattggcg agactcaagg gttcaggtgg ggctacgtcc
      121 ccacccaact cgataaagat aaccaaccaa gatatggctc tggggctgat tggacaggtc
      181 ccagcgccaa aggccacatc cgtcgatgtc cctaaacaac agagggatag accaccacgg
      241 actgttgccg aagttcaaca aaatttgcgt tggactgaga gaccacaaga ccagaatgtt
      301 aagacgtggg atgagcttga ccacacaaca aaacaacaga tacttgatga acacgctgag
      361 tggtttgatg ccggtggctt aggtccaagt acactaccca ctagtcatga acggtacaca
      421 catgagaatg atgaaggcca ccaggtaaag tggtcggcta gggaaggtgt agaccttggc
      481 atatccgggc tcacgacggt gtctgggcct gagtggaata tgtgcccgct accaccagtt
      541 gaccaaagga gcacgacacc tgcaactgag cccacaattg gtgacatgat cgaattctat
      601 gaagggcaca tctatcatta tgctatatac ataggtcaag gcaagacggt gggtgtacac
      661 tcccctcaag cagccttctc aataacgagg atcaccatac agcccatatc agcttggtgg
      721 cgagtctgtt atgtcccaca accaaaacag aggctcacat acgaccaact caaagaatta
      781 gaaaatgaac catggccgta tgccgcagtc acgaacaact gcttcgaatt ttgttgccag
      841 gtcatgtgct tggaagatac ttggttgcaa aggaagctca tctcctctgg ccggttttac
      901 cacccgaccc aagattggtc ccgagacact ccagaattcc aacaagacag caagttagag
      961 atggttaggg atgcagtgct agccgctata aatgggttgg tgtcgcggcc atttaaagat
     1021 cttctgggta agctcaaacc cttgaacgtg cttaacttac tttcaaactg tgattggacg
     1081 ttcatggggg tcgtggagat ggtggtcctc cttttagaac tctttggaat cttttggaac
     1141 ccacctgatg tttccaactt tatagcttca ctcctgccag atttccatct acagggcccc
     1201 gaggaccttg ccagggatct cgtgccaata gtattggggg ggatcggctt agccatagga
     1261 ttcaccagag acaaggtaag taagatgatg aagaatgctg ttgatggact tcgtgcggca
     1321 acccagctcg gtcaatatgg cctagaaata ttctcattac taaagaagta cttcttcggt
     1381 ggtgatcaaa cagagaaaac cctaaaagat attgagtcag cagttataga tatggaagta
     1441 ctatcatcta catcagtgac tcagctcgtg agggacaaac agtctgcacg ggcttatatg
     1501 gccatcttag ataatgaaga agaaaaggca aggaaattat ctgtcaggaa tgccgaccca
     1561 cacgtagtat cctctaccaa tgctctcata tcccggatct caatggctag ggctgcattg
     1621 gccaaggctc aagctgaaat gaccagcagg atgcgtcctg tggtcattat gatgtgtggg
     1681 ccccctggta taggtaaaac caaggcagca gaacatctgg ctaaacgcct agccaatgag
     1741 atacggcctg gtggtaaggt tgggctggtc ccacgggagg cagtggatca ttgggatgga
     1801 tatcacggag aggaagtgat gctgtgggac gactatggaa tgacaaagat acaggaagac
     1861 tgtaataaac tgcaagccat agccgactca gcccccctaa cactcaattg tgaccgaata
     1921 gaaaacaagg gaatgcaatt tgtgtctgat gctatagtca tcaccaccaa tgctcctggc
     1981 ccagccccag tggactttgt caacctcggg cctgtttgcc gaagggtgga cttccttgtg
     2041 tattgcacgg cacctgaagt tgaacacacg aggaaagtca gtcctgggga cacaactgca
     2101 ctgaaagact gcttcaagcc cgatttctca catctaaaaa tggagttggc tccccaaggg
     2161 ggctttgata accaagggaa taccccgttt ggtaagggtg tgatgaagcc caccaccata
     2221 aacaggctgt taatccaggc tgtagccttg acgatggaga gacaggatga gttccaactc
     2281 caggggccta cgtatgactt tgatactgac agagtagctg cgttcacgag gatggcccga
     2341 gccaacgggt tgggtctcat atccatggcc tccctaggca aaaagctacg cagtgtcacc
     2401 actattgaag gattaaagaa tgctctatca ggctataaaa tatcaaaatg cagtatacaa
     2461 tggcagtcaa gggtgtacat tatagaatca gatggtgcca gtgtacaaat caaagaagac
     2521 aagcaagctt tgacccctct gcagcagaca attaacacgg cctcacttgc catcactcga
     2581 ctcaaagcag ctagggctgt ggcatacgct tcatgtttcc agtccgccat aactaccata
     2641 ctacaaatgg cgggatctgc gctcgttatt aatcgagcgg tcaagcgtat gtttggtacc
     2701 cgtacagcag ccatggcatt agaaggacct gggaaagaac ataattgcag ggtccataag
     2761 gctaaggaag ctggaaaggg gcccataggt catgatgaca tggtagaaag gtttggccta
     2821 tgtgaaactg aagaggagga gagtgaggac caaattcaaa tggtaccaag tgatgccgtc
     2881 ccagaaggaa agaacaaagg caagaccaaa aagggacgtg gtcgcaaaaa taactataat
     2941 gcattctctc gccgtggtct gagtgatgaa gaatatgaag agtacaaaaa gatcagagaa
     3001 gaaaagaatg gcaattatag tatacaagaa tacttggagg accgccaacg atatgaggaa
     3061 gaattagcag aggtacaggc aggtggtgat ggtggcatag gagaaactga aatggaaatc
     3121 cgtcacaggg tcttctataa atccaagagt aagaaacacc aacaagagca acggcgacaa
     3181 cttggtctag tgactggatc agacatcaga aaacgtaagc ccattgactg gaccccgcca
     3241 aagaatgaat gggcagatga tgacagagag gtggattata atgaaaagat caattttgaa
     3301 gctcccccga cactatggag ccgagtcaca aagtttggat caggatgggg cttttgggtc
     3361 agcccgacag tgttcatcac aaccacacat gtagtgccaa ctggtgtgaa agaattcttt
     3421 ggtgagcccc tatctagtat agcaatccac caagcaggtg agttcacaca attcaggttc
     3481 tcaaagaaaa tgcgccctga cttgacaggt atggtccttg aagaaggttg ccctgaaggg
     3541 acagtctgct cagtcctaat taaacgggat tcgggtgaac tacttccgct agccgtccgt
     3601 atgggggcta ttgcctccat gaggatacag ggtcggcttg tccatggcca atcagggatg
     3661 ttactgacag gggccaatgc aaaggggatg gatcttggca ctataccagg agactgcggg
     3721 gcaccatacg tccacaagcg cgggaatgac tgggttgtgt gtggagtcca cgctgcagcc
     3781 acaaagtcag gcaacaccgt ggtctgcgct gtacaggctg gagagggcga aaccgcacta
     3841 gaaggtggag acaaggggca ttatgccggc cacgagattg tgaggtatgg aagtggccca
     3901 gcactgtcaa ctaaaacaaa attctggagg tcctccccag aaccactgcc ccccggagta
     3961 tatgagccag catacctggg gggcaaggac ccccgtgtac agaatggccc atccctacaa
     4021 caggtactac gtgaccaact gaaacccttt gcggaccccc gcggccgcat gcctgagcct
     4081 ggcctactgg aggctgcggt tgagactgta acatccatgt tagaacagac aatggatacc
     4141 ccaagcccgt ggtcttacgc tgatgcctgc caatctcttg acaaaactac tagttcgggg
     4201 taccctcacc ataaaaggaa gaatgatgat tggaatggca ccaccttcgt tggagagctc
     4261 ggtgagcaag ctgcacacgc caacaatatg tatgagaatg ctaaacatat gaaacccatt
     4321 tacactgcag ccttaaaaga tgaactagtc aagccagaaa agatttatca aaaagtcaag
     4381 aagcgtctac tatggggcgc cgatctcgga acagtggtca gggccgcccg ggcttttggc
     4441 ccattttgtg acgctataaa atcacatgtc atcaaattgc caataaaagt tggcatgaac
     4501 acaatagaag atggccccct catctatgct gagcatgcta aatataagaa tcattttgat
     4561 gcagattata cagcatggga ctcaacacaa aatagacaaa ttatgacaga atccttctcc
     4621 attatgtcgc gccttacggc ctcaccagaa ttggccgagg ttgtggccca agatttgcta
     4681 gcaccatctg agatggatgt aggtgattat gtcatcaggg tcaaagaggg gctgccatct
     4741 ggattcccat gtacttccca ggtgaacagc ataaatcact ggataattac tctctgtgca
     4801 ctgtctgagg ccactggttt atcacctgat gtggtgcaat ccatgtcata tttctcattt
     4861 tatggtgatg atgagattgt gtcaactgac atagattttg acccagcccg cctcactcaa
     4921 attctcaagg aatatggcct caaaccaaca aggcctgaca aaacagaagg accaatacaa
     4981 gtgaggaaaa atgtggatgg actggtcttc ttgcggcgca ccatttcccg tgatgcggca
     5041 gggttccaag gcaggttaga tagggcttcg attgaacgcc aaatcttctg gacccgcggg
     5101 cccaatcatt cagatccatc agagactcta gtgccacaca ctcaaagaaa aatacagttg
     5161 atttcacttc taggggaagc ttcactccat ggtgagaaat tttacagaaa gatttccagc
     5221 aaggtcatac atgaaatcaa gactggtgga ttggaaatgt atgtcccagg atggcaggcc
     5281 atgttccgct ggatgcgctt ccatgacctc ggattgtgga caggagatcg cgatcttctg
     5341 cccgaattcg taaatgatga tggcgtctaa ggacgctaca tcaagcgtgg atggcgctag
     5401 tggcgctggt cagttggtac cggaggttaa tgcttctgac cctcttgcaa tggatcctgt
     5461 agcaggttct tcgacagcag tcgcgactgc tggacaagtt aatcctattg atccctggat
     5521 aattaataat tttgtgcaag ccccccaagg tgaatttact atttccccaa ataatacccc
     5581 cggtgatgtt ttgtttgatt tgagtttggg tccccatctt aatcctttct tgctccatct
     5641 atcacaaatg tataatggtt gggttggtaa catgagagtc aggattatgc tagctggtaa
     5701 tgcctttact gcggggaaga taatagtttc ctgcataccc cctggttttg gttcacataa
     5761 tcttactata gcacaagcaa ctctctttcc acatgtgatt gctgatgtta ggactctaga
     5821 ccccattgag gtgcctttgg aagatgttag gaatgttctc tttcataata atgatagaaa
     5881 tcaacaaacc atgcgccttg tgtgcatgct gtacaccccc ctccgcactg gtggtggtac
     5941 tggtgattct tttgtagttg cagggcgagt tatgacttgc cccagtcctg attttaattt
     6001 cttgttttta gtccctccta cggtggagca gaaaaccagg cccttcacac tcccaaatct
     6061 gccattgagt tctctgtcta actcacgtgc ccctctccca atcagtagta tgggcatttc
     6121 cccagacaat gtccagagtg tgcagttcca aaatggtcgg tgtactctgg atggccgcct
     6181 ggttggcacc accccagttt cattgtcaca tgttgccaag ataagaggga cctccaatgg
     6241 cactgtaatc aaccttactg aattggatgg cacacccttt cacccttttg agggccctgc
     6301 ccccattggg tttccagacc tcggtggttg tgattggcat atcaatatga cacagtttgg
     6361 ccattctagc cagacccagt atgatgtaga caccacccct gacacttttg tcccccatct
     6421 tggttcaatt caggcaaatg gcattggcag tggtaattat gttggtgttc ttagctggat
     6481 ttccccccca tcacacccgt ctggctccca agttgacctt tggaagatcc ccaattatgg
     6541 gtcaagtatt acggaggcaa cacatctagc cccttctgta tacccccctg gtttcggaga
     6601 ggtattggtc tttttcatgt caaaaatgcc aggtcctggt gcttataatt tgccctgtct
     6661 attaccacaa gagtacattt cacatcttgc tagtgaacaa gcccctactg taggtgaggc
     6721 tgccctgctc cactatgttg accctgatac cggtcggaat cttggggaat tcaaagcata
     6781 ccctgatggt ttcctcactt gtgtccccaa tggggctagc tcgggtccac aacagctgcc
     6841 gatcaatggg gtctttgtct ttgtttcatg ggtgtccaga ttttatcaat taaagcctgt
     6901 gggaactgcc agctcggcaa gaggtaggct tggtctgcgc cgataatggc ccaagccata
     6961 attggtgcaa ttgctgcttc cacagcaggt agtgctctgg gagcgggcat acaggttggt
     7021 ggcgaagcgg ccctccaaag ccaaaggtat caacaaaatt tgcaactgca agaaaattct
     7081 tttaaacatg acagggaaat gattgggtat caggttgaag cttcaaatca attattggct
     7141 aaaaatttgg caactagata ttcactcctc cgtgctgggg gtttgaccag tgctgatgca
     7201 gcaagatctg tggcaggagc tccagtcacc cgcattgtag attggaatgg cgtgagagtg
     7261 tctgctcccg agtcctctgc taccacattg agatccggtg gcttcatgtc agttcccata
     7321 ccatttgcct ctaagcaaaa acaggttcaa tcatctggta ttagtaatcc aaattattcc
     7381 ccttcatcca tttctcgaac cactagttgg gtcgagtcac aaaactcatc gagatttgga
     7441 aatctttctc cataccacgc ggaggctctc aatacagtgt ggttgactcc acccggttca
     7501 acagcctctt ctacactgtc ttctgtgcca cgtggttatt tcaatacaga caggttgcca
     7561 ttattcgcaa ataataggcg atgatgttgt aatatgaaat