Typing tool

Complete norovirus genomes

KC631814  GII.4 Yerseke
 GII.P4 Yerseke

Length: 7,575 | 3 CDS

ORF1: 5..5104
ORF2: 5085..6707
ORF3: 6707..7513
LOCUS       KC631814                7575 bp    RNA     linear   VRL 15-AUG-2013
DEFINITION  Norovirus Hu/GII.4/MI001/2011/USA ORF-1, ORF-2, and ORF-3 genes,
            complete cds.
ACCESSION   KC631814
VERSION     KC631814.1
KEYWORDS    .
SOURCE      Norovirus Hu/GII.4/MI001/2011/USA
  ORGANISM  Norovirus Hu/GII.4/MI001/2011/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7575)
  AUTHORS   Taube,S., Kolawole,A.O., Hohne,M., Wilkinson,J.E., Handley,S.A.,
            Perry,J.W., Thackray,L.B., Akkina,R. and Wobus,C.E.
  TITLE     A mouse model for human norovirus
  JOURNAL   MBio 4 (4), e00450-13 (2013)
   PUBMED   23860770
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 7575)
  AUTHORS   Taube,S., Kolawole,A.O., Hoehne,M., Handley,S.A., Perry,J.W.,
            Thackray,L.B., Akkina,R. and Wobus,C.E.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-FEB-2013) Microbiology and Immunology, University of
            Michigan Medical School, 1150 West Medical Center Dr., Ann Arbor,
            MI 48109-5620, USA
COMMENT     ##Assembly-Data-START##
            Sequencing Technology :: Sanger dideoxy sequencing
            ##Assembly-Data-END##
FEATURES             Location/Qualifiers
     source          1..7575
                     /organism="Norovirus Hu/GII.4/MI001/2011/USA"
                     /mol_type="genomic RNA"
                     /strain="Hu/GII.4/MI001/2011/USA"
                     /host="Homo sapiens"
                     /db_xref="taxon:1354724"
                     /lab_host="Mus musculus"
                     /country="USA"
                     /collection_date="2011"
                     /PCR_primers="fwd_seq: gtgaatgaagatggcgtctaacgacgcttccgct,
                     rev_seq: taaaaaaaaaaaaaaa"
                     /note="genotype: GII.4"
     CDS             5..5104
                     /note="nonstructural polyprotein"
                     /codon_start=1
                     /product="ORF-1"
                     /protein_id="AGQ46693.1"
                     /translation="MKMASNDASAAAVANSNNDTAKSSSDGVLSSMAVTFKRALGARP
                     KQPPPREIPQRPPRPPTPELVKNIPPPPPNGEDEIVVSYSVKDGVSGLPDLSTVRQPE
                     ESNTAFSVPPLNQRENRDAKEPLTGTILEMWDGEIYHYGLYVERGLVLGVHKPPAAIS
                     LARVELAPLSLYWRPVYTPQYLISPDTLKKLHGETFPYTAFDNNCYAFCCWVLDLNDS
                     WLSRRMIQRTTGFFRPYQDWNRKPLPTMDDSKLKKVANIFLCALSSLFTRPIKDIIGK
                     LRPLNILNILASCDWTFAGIVESLILLAELFGVFWTPPDVSAMIAPLLGDYELQGPED
                     LAVELVPVVMGGIGLVLGFTKEKIGKMLSSAASTLRACKDLGAYGLEILKLVMKWFFP
                     KKEEANELAIVRSIEDAVLDLEAIENNHMTTLLKDKDSLATYMRTLDLEEEKARKLST
                     KSASPDIVGTINALLARIAAARSLVHRAKEELSSRPRPVVLMISGRPGIGKTHLAREM
                     AKRIAASLTGDQRVGLVPRNGVDHWDAYKGERVVLWDDYGMSNPIHDALRLQELADTC
                     PLTLNCDRIENKGKVFDSDVIIITTNLANPAPLDYVNFEACSRRIDFLVYAEAPEVEK
                     AKRDFPGQPDMWKNAFSSDFSHIKLTLAPQGGFDKNGNTPHGRGVMKTLTTGSLIARA
                     SGLLHERLDEFELQGPTLTTFNFDRNKVLAFRQLAAENKYGLMDTMRVGRQLKDVRTM
                     PELKQALKNISIKKCQIVYSGCTYILESDGKGNVKVDRVQSASVQTNNELTGALHHLR
                     CARIRYYVKCVQEALYSIIQIAGAAFVTTRIVKRMNIQDLWSKPQVENTEETTSEDGC
                     PKPKDNEEFVISSDDIKTEGKKGKNKTGRGKKHTAFSSKGLSDEEYDEYKRIREERNG
                     KYSIEEYLQDRDKYYEEVAIARATEEDFCEEEEAKIRQRIFRPTRKQRKEERASLGLV
                     TGSEIRKRNPDDFKPKGKLWADDDRSVDYNEKLSFEAPPSIWSRIVNFGSGWGFWVSP
                     SLFITSTHVIPQGAKEFFGVPIKQIQVHKSGEFCRLRFPKPIRTDVTGMILEEGAPEG
                     TVVTLLIKRSTGELMPLAARMGTHATMKIQGRTVGGQMGMLLTGSNAKSMDLGTTPGD
                     CGCPYIYKRGNDYVVIGVHTAAARGGNTVICATQGSEGEATLEGGDNKGTYCGAPILG
                     PGSAPKLSTKTKFWRSSTASLPPGTYEPAYLGGKDPRVKGGPSLQQVMREQLKPFTEP
                     RGKPPKPSVLEAAKKTIINVLEQTIDPPEKWSFAQACASLDKTTSSGHPHHMRKNDCW
                     NGESFTGKLADQASKANLMFEEGKNMTPVYTAALKDELVKTDKIYGKIKKRLLWGSDL
                     ATMIRCARAFGGLMDELKAHCVTLPIRVGMNMNEDGPIIFERHSRYTYHYDADYSRWD
                     STQQRAVLAAALEIMVKFSPEPHLAQVVAEDLLSPSVVDVGDFTISINEGLPSGVPCT
                     SQWNSIAHWLLTLCALSEVTNLSPDTIQANSLFSFYGDDEIVSTDIKLDPEKLTAKLR
                     EYGLKPTRPDKTEGPLVISEDLNGLTFLRRTVTRDPAGWFGKLEQGSILRQMYWTRGS
                     NHEDPSETMIPHSQRPVQLMSLLGEAALHGPAFYSKISKLVIAELKEGGMDFYVPRQE
                     PMFRWMRFSDLSTWEGDRNLAPSFVNEDGVE"
     CDS             5085..6707
                     /note="VP1"
                     /codon_start=1
                     /product="ORF-2"
                     /protein_id="AGQ46694.1"
                     /translation="MKMASSDANPSDGSTANLVPEVNNEVMALEPVVGAAIAAPVAGQ
                     QNVIDPWIRNNFVQAPGGEFTVSPRNAPGEILWSAPLGPDLNPYLSHLARMYNSYAGG
                     FEVQVILAGNAFTAGKIIFAAVPPNFPTEGLSPSQVTMFPHIIVDVRQLEPVLIPLPD
                     VRNNFYHYNQSNDPTIKLIAMLYTPLRANNAGDDVFTVSCRVLTRPSPDFDFIFLVPP
                     TVESRTKPFSVPILTVEEMTNSRFPIPLEKLFTGPSSAFVVQPQNGRCTTDGVLLGTT
                     QLSPVNICTFRGDVTHIAGTQEYTMNLASQNWNNYDPTEEIPAPLGTPDFVGKIQGVL
                     TQTTRRDGSTRGHKATVSTGSVHFTPKLGRIQFSTDTSNDFETGQNTRFTPVGVVQDG
                     STTHQNEPQQWVLPNYSGRDSHNVHLAPAVAPSFPGEQLLFFRSTMPGCSGYPNMNLD
                     CLLPQEWVQHFYQEAAPAQSDVALLRFVNPDTGRVLFECKLHKSGYVTVAHTGQHDLV
                     IPPNGYFRFDSWVNQFYTLAPMGNGTGRRRAL"
     CDS             6707..7513
                     /note="VP2"
                     /codon_start=1
                     /product="ORF-3"
                     /protein_id="AGQ46695.1"
                     /translation="MAGAFFAGLASDVLGSGLGSLINAGAGAINQKVEFENNRKLQQA
                     SFQFSSNLQQASFQHDKEMLQAQIEATKKLQQEMIKVKQAMLLEGGFSETDAARGAIS
                     APMTKTLDWSGTRYWAPDARTTTYNAGRFSTPQPSGALPGRTNLRAAVPAWGSSSTPS
                     NSSTATSVYSNQTASTRLGSTAGSGTSVSSFPSTARTRSWVEDQNRNLSPFMRGAHNI
                     SFVTPPSSRSSSQGTVSTVPKEVLDSWTGAFNTRRQPLFAHIRKRGESRA"
ORIGIN      
        1 gtgaatgaag atggcgtcta acgacgcttc cgctgccgct gttgctaaca gcaacaacga
       61 caccgcaaaa tcttcaagtg acggagtgct ttctagcatg gctgtcactt ttaaacgggc
      121 cctcggggcg cggcctaaac agcctccccc gagggaaata ccacaaagac ccccacgacc
      181 acctactcca gaactggtta aaaatattcc ccctcccccg cccaacggag aggatgaaat
      241 agtggtttct tatagtgtca aagatggtgt ttccggttta cctgaccttt ccaccgtcag
      301 gcaaccggaa gaatctaaca cggccttcag tgtccctcca ctcaatcaga gggagaatag
      361 agatgctaag gagccactga ctggaacaat tctggaaatg tgggatggag aaatctacca
      421 ttatggcctg tatgtggagc gaggtcttgt actaggtgtg cacaaaccac cagctgccat
      481 tagcctcgct agggtcgagc tagcaccact ctccttgtac tggagacctg tgtacactcc
      541 ccagtacctc atctctccag acactctcaa gaaattacac ggagaaacgt tcccctacac
      601 agcctttgat aacaattgtt atgccttttg ttgctgggtc ctggacctaa atgactcgtg
      661 gctgagcagg agaatgatcc agagaacaac tggtttcttc aggccctacc aagattggaa
      721 taggaaaccc ctccccacta tggatgactc caaattaaag aaggtagcta acatattcct
      781 gtgtgctctg tcttcgctat tcaccaggcc cataaaagat ataataggga agctaaggcc
      841 tcttaacatc ctcaacatct tagcctcatg tgattggact tttgcaggca tagtggagtc
      901 cctgatactc ttggcagaac tctttggagt tttctggaca cccccagatg tgtctgcgat
      961 gattgccccc ttactcggtg actacgagct acaaggacct gaggaccttg cagtggagct
     1021 cgtccccgta gtgatggggg gaattggttt ggtgctagga ttcaccaaag agaagattgg
     1081 gaaaatgttg tcatctgctg catccacctt aagagcttgt aaagaccttg gtgcatatgg
     1141 gctagagatc ctaaagttgg tcatgaagtg gttcttcccg aagaaggagg aagcaaatga
     1201 attggctata gtgagatcta tcgaggatgc agtcctggat ctcgaggcaa ttgaaaacaa
     1261 ccatatgacc accttgctca aagacaaaga cagtctggca acctatatga gaacccttga
     1321 ccttgaggag gagaaagcca ggaaactctc aaccaagtct gcctcacctg acatcgtggg
     1381 cacaatcaac gcccttctgg cgagaatcgc tgctgcacgc tctctggtgc atcgagcgaa
     1441 ggaggaactt tccagcagac caagacctgt agtattgatg atatcaggca gaccaggaat
     1501 agggaagacc caccttgcta gggaaatggc taagagaatc gcagcctccc ttacaggaga
     1561 ccagcgtgta ggcctggtcc cacgcaatgg cgtcgaccac tgggatgcgt acaaggggga
     1621 gagggtcgtc ctatgggacg attatgggat gagcaatccc attcacgatg ccctcaggtt
     1681 gcaagaactc gctgacactt gccccctcac tctaaactgt gacaggattg agaacaaagg
     1741 aaaggtcttt gacagcgatg tcatcattat caccactaat ctggccaacc cagcaccact
     1801 ggactatgtc aactttgaag catgctcgag gcgcatcgac ttcctcgtgt atgcagaagc
     1861 tcctgaagtc gaaaaggcga agcgtgactt cccaggccaa cctgacatgt ggaagaacgc
     1921 cttcagttct gatttctcac acataaaact aacattggcc ccacagggtg gcttcgacaa
     1981 gaacgggaac accccacacg gaaggggcgt catgaagact ctcaccactg gctcccttat
     2041 tgcccgggca tcaggactac tccatgagag gttagatgaa tttgaactac agggcccaac
     2101 tctcactacc ttcaatttcg atcgcaataa agtgcttgcc tttagacaac ttgctgctga
     2161 aaacaaatat gggttgatgg acacaatgag agttgggaga cagctcaagg atgtcagaac
     2221 catgccagaa ctcaaacaag cactcaagaa catttcaatc aagaagtgcc agatagtgta
     2281 tagtggttgc acctatatac ttgagtctga tggcaagggc aatgtgaaag ttgatagagt
     2341 tcagagcgcc tccgtgcaga ccaacaatga gctgactggt gccctgcacc atttgaggtg
     2401 cgccaggatc agatactatg tcaagtgtgt ccaggaggcc ctgtattcca tcatccaaat
     2461 tgctggggct gcgtttgtca ccacgcgcat cgtcaagcgc atgaacatac aagacctatg
     2521 gtccaagcca caagtggaaa acacagagga gaccaccagt gaggacgggt gcccaaaacc
     2581 caaagataat gaggagtttg tcatttcatc cgacgacatc aaaactgagg gtaagaaagg
     2641 gaagaacaag actggccgcg gcaagaagca cacagccttt tcaagcaaag gtctcagtga
     2701 tgaagagtac gatgagtaca agaggattag agaagaaagg aatggcaagt actccataga
     2761 agagtacctt caggacaggg acaaatacta tgaggaggtg gccattgcca gggcgactga
     2821 ggaagacttc tgtgaagagg aggaggccaa gatccggcaa aggatcttca ggccaacaag
     2881 gaaacaacgc aaggaggaaa gagcttctct cggtctggtc acaggttccg aaattaggaa
     2941 aagaaaccca gatgatttca aacccaaggg gaaactgtgg gctgacgatg acagaagtgt
     3001 ggactataat gagaaactca gctttgaggc cccaccaagc atctggtcga ggatagtcaa
     3061 ctttggttca ggttggggat tctgggtctc ccccagtctg ttcataacat caacccatgt
     3121 cataccccag ggcgcaaagg agttctttgg agtccccatc aaacaaattc aggtacacaa
     3181 gtcaggcgag ttctgtcgct tgagattccc aaaaccaatc aggactgatg tgacaggcat
     3241 gatcttagaa gaaggcgcac ccgagggcac cgtggtcaca ctactcatca aaaggtccac
     3301 tggggaactc atgcccctag cagctaggat ggggacccat gcaaccatga agatccaagg
     3361 gcgcaccgtt ggaggccaaa tgggcatgct tctgacagga tccaacgcca aaagcatgga
     3421 tctgggtact acaccaggtg attgtggctg tccctacatc tacaagagag gaaatgacta
     3481 tgtggtcatt ggagtccaca cggctgccgc tcgtggggga aacactgtca tatgtgccac
     3541 ccaggggagt gagggagagg ctacacttga aggtggtgac aacaagggga catactgtgg
     3601 tgcaccaatc ctaggcccag ggagtgcccc aaaacttagc accaagacca aattctggag
     3661 atcgtccacg gcatcactcc cacctggcac ctatgaacca gcctatcttg gtggcaagga
     3721 ccctagagtc aagggtggcc cttcactgca gcaagttatg agggaacagt tgaagccatt
     3781 cacagagccc aggggcaagc caccaaagcc aagtgtgtta gaagctgcca agaagaccat
     3841 catcaatgtc cttgagcaaa caattgatcc acctgagaaa tggtcattcg cacaagcttg
     3901 cgcgtccctt gacaagacca cttccagtgg ccatccgcac cacatgcgga aaaacgactg
     3961 ctggaacggg gagtccttca caggcaagct agcagaccag gcttccaagg ccaatctgat
     4021 gtttgaagaa gggaagaaca tgaccccagt ctacacagct gcgctcaagg atgaattagt
     4081 taaaaccgac aaaatttatg gtaagatcaa gaagaggctt ctctggggct cggacttggc
     4141 gaccatgatc cggtgtgctc gagcattcgg aggcctaatg gatgagctca aagcacactg
     4201 tgtcacactt cccattagag ttggtatgaa tatgaatgag gatggcccca tcatcttcga
     4261 gaggcattcc aggtacacat atcactatga tgctgattac tctcgatggg attcaacaca
     4321 acagagagcc gtgttggcag cagctctaga aatcatggtt aaattctccc cagaaccaca
     4381 tttggctcag gtggtcgcgg aagaccttct ttctcctagc gtggtggacg tgggcgactt
     4441 cacaatatca atcaacgagg gtcttccctc tggggtgccc tgcacctccc aatggaactc
     4501 catcgcccac tggcttctca ctctttgtgc gctctctgaa gttacaaact tgtcccctga
     4561 taccatacag gctaattccc tcttctcttt ttatggtgat gatgaaattg ttagcacaga
     4621 cataaaattg gacccagaga aattgacagc aaagctcagg gaatatgggt taaaaccaac
     4681 ccgtcctgac aaaactgaag gaccccttgt catctctgaa gacttgaatg gcctgacctt
     4741 cctgcggaga actgtgaccc gcgatccagc tggttggttt ggaaaactgg agcagggttc
     4801 aatactcagg caaatgtact ggactagggg ctccaaccat gaagacccat ctgaaacaat
     4861 gattccacac tcccaaagac ccgtacaatt gatgtcccta ctgggggagg ccgctcttca
     4921 cggcccagca ttctacagca aaatcagcaa gttagtcatt gcagagctaa aagaaggtgg
     4981 catggatttt tacgtgccca gacaagagcc aatgttcaga tggatgagat tctcagatct
     5041 tagcacgtgg gagggcgatc gcaatctggc tcccagtttt gtgaatgaag atggcgtcga
     5101 gtgacgccaa cccatctgat gggtccacag ccaacctcgt cccagaggtc aacaatgagg
     5161 ttatggcttt ggagcccgtt gttggtgccg ctattgcggc acctgtagcg ggccaacaaa
     5221 atgtaattga cccctggatt agaaataatt ttgtacaagc ccctggtgga gagtttacag
     5281 tatcccctag aaacgctcca ggtgaaatac tatggagcgc gcccttgggc cctgatttga
     5341 atccctacct ttcccatttg gccagaatgt acaatagtta tgcaggtggt tttgaagtgc
     5401 aggtaatcct cgcggggaac gcgttcaccg ccggaaaaat catatttgca gcagtcccac
     5461 caaatttccc aactgaaggc ttgagcccca gccaggtcac tatgttcccc catataatag
     5521 tagatgttag gcaactggaa cctgtgttga tccccttacc cgatgttagg aataatttct
     5581 atcactacaa tcaatcaaat gaccccacca tcaaattgat agcaatgttg tatacaccac
     5641 ttagggctaa taatgctggg gacgatgtct tcacagtttc ttgtcgggtt ctcacgagac
     5701 catcccccga ttttgatttc atatttttag tgccacccac agttgagtca agaactaaac
     5761 cattctctgt cccaatttta actgttgagg agatgaccaa ttcaagattc cccattcctt
     5821 tggaaaagtt gttcacgggt cccagcagtg cctttgttgt tcaaccacaa aatggcaggt
     5881 gcacgactga tggcgtgctc ctaggtacta cccaactgtc tcctgtcaac atctgcacct
     5941 tcagagggga tgtcacccac attgcaggta ctcaagaata cacaatgaat ctggcctccc
     6001 aaaactggaa caattatgat ccaacagaag aaatcccagc ccctctggga actccagatt
     6061 tcgtgggtaa gatccaaggc gtgctcaccc aaaccacaag gagggatggc tcgacccgcg
     6121 gtcacaaagc cacagtgagc actggaagtg tccacttcac cccaaagctg ggcagaattc
     6181 aattctccac tgatacaagc aatgattttg aaactggcca aaacacgaga ttcaccccag
     6241 tcggtgttgt ccaggatggt agcaccaccc accaaaatga accccaacaa tgggtactcc
     6301 caaattattc aggtagagat agccacaatg tgcacctagc ccctgctgtg gccccctctt
     6361 ttccgggtga gcaacttctt ttcttcaggt ccactatgcc cggatgcagc gggtatccca
     6421 acatgaattt ggattgccta ctcccccagg agtgggtgca gcacttctac caagaggcag
     6481 ccccagcaca atctgatgtg gctctgctaa gatttgtgaa tccagacaca ggtagggttc
     6541 tgtttgagtg taagcttcat aaatcaggct atgtcacagt ggctcacact ggccaacatg
     6601 atttagttat cccccccaat ggctatttta ggtttgattc ctgggtcaac cagttctaca
     6661 cacttgcccc catgggaaat ggaacggggc gtagacgtgc attataatgg ctggagcttt
     6721 ctttgctgga ttggcatctg atgtccttgg ctctggactt ggttccctaa tcaatgctgg
     6781 ggctggggcc atcaaccaaa aagttgaatt tgaaaataac agaaaattgc aacaagcttc
     6841 cttccaattt agcagcaacc tacaacaggc ttcctttcaa catgataaag agatgctcca
     6901 agcacaaatt gaggccacca aaaagttgca acaggaaatg ataaaagtta aacaggcaat
     6961 gctcctagag ggtgggttct ctgagacaga tgcagcccgt ggggcaatca gcgcccccat
     7021 gacaaagact ttggactgga gcgggacaag gtactgggct cccgatgcta ggactacaac
     7081 atacaatgca ggccgctttt ccacccctca accctcgggg gcactgccag gaagaactaa
     7141 tcttagggct gctgtccccg cctggggctc ctccagtaca ccttctaact cttctactgc
     7201 tacttctgtg tactcaaatc aaactgcttc aacgagactt ggttctacag ctggttctgg
     7261 taccagtgtc tcgagcttcc cgtcaactgc aaggactagg agctgggttg aggatcaaaa
     7321 taggaatttg tcacctttca tgaggggggc ccacaacata tcgtttgtca ccccaccatc
     7381 tagcagatcc tctagccaag gcacagtctc aaccgtgcct aaagaagttt tggactcctg
     7441 gactggcgct ttcaacacgc gcaggcagcc tctcttcgct cacattcgta agcgagggga
     7501 gtcacgggcg taatgtgaaa agacaaaatt gactatcttt ctttttcttt agtgtctttt
     7561 aaaaaaaaaa aaaaa
//