Typing tool

Complete norovirus genomes

KC576909  GII.4 Den Haag
 GII.P4 Den Haag

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KC576909                7509 bp ss-RNA     linear   VRL 23-OCT-2013
DEFINITION  Norovirus Hu/GII.4/NIHIC4.2/2011/USA, complete genome.
VERSION     KC576909.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII.4/NIHIC4.2/2011/USA
  ORGANISM  Norovirus Hu/GII.4/NIHIC4.2/2011/USA
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., Kim,M., Bok,K.,
            Sosnovtsev,S.V., Wentworth,D.E. and Green,K.Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (01-FEB-2013) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 282.5x
            Sequencing Technology    :: Sanger; Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII.4/NIHIC4.2/2011/USA"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens"
                     /country="USA: Maryland"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_7_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_7_Reverse, rev_seq:
                     /note="genotype: GII.4"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calcivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caaatgacaa gatgttttct aacatggctg tcactcttaa aagagccctc
      121 ggggcgcggc ctaaacagcc ccccccgagg gaaataccac aaagaccccc acgaccacct
      181 actccagaac tgatcaaaaa gatccctcct cccccgccca acggagagga tgaagtagtg
      241 gtttcttata gtgccaaaga tggcgtttcc ggtttgcctg agctttccac cgtcaggcaa
      301 ccggaagaaa ccaatacggc cttcagtgtc cctccactca atcagaggga gaatagggac
      361 gctaaggaac cactgactgg aacaattctg gaaatgtggg atggagaaat ctaccattat
      421 ggcctgtatg ttgagcgagg tcttgtgctg ggtgtgcaca aaccaccagc tgccattagc
      481 cacgccaggg tcgaattaac accactctcc ttgttctgga gacctgtgta cactcctcag
      541 tacctcattt ctccagacac tctcaagaag ttacacggag aaacatttcc ctacacagcc
      601 tttgacaaca actgctatgc cttttgttgt tgggtcctgg acctaaacga ctcgtggctg
      661 agcaggagaa tgatccagag aacaactggc ttcttcagac cctaccaaga ttggaatagg
      721 aaacccctcc ccactatgga tgattccaaa ttaaagaagg tagctaacat attcctgtgt
      781 gccctgtctt cgctattcac caggcccata aaagacataa taggaaggtt aaggcctctc
      841 aacatcatca acatcctggc ctcatgtgat tggactttcg cgggcatagt ggagtccttg
      901 atactcttgg cagagctctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac tcggtgattt cgagttacaa ggacctgaag accttgtagt ggagctcgtc
     1021 cctgtagtaa tgggggggat tggtctggtg ctaggattca ccaaagagaa gattggaaaa
     1081 atgttgtcat ctgctgcatc caccttgaga gcttgtaaag accttggtgc atatgggcta
     1141 gaaatcttaa agttagtcat gaagtggttc ttcccgaaga aagaggaagc taatgaactg
     1201 gccatggtga gatccatcga ggatgcggta ctggaccttg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagatagc ctggcaacct acatgagaac ccttgacctc
     1321 gaggaagaga aagccagaaa actctcaacc aagtctgctt cacctgacat cgtgggcaca
     1381 atcaacgcgc ttctggcgag aatcgccgct gcacgctccc tggtgcaccg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtagtc ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc ttgctaggga agtggctaag agaatcgcag cctccctcac aggagaccag
     1561 cgtgtaggcc tcatcccacg caatggcgtc gatcactggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgacta tggaatgagc aatcccatcc acgacgccct cagactgcaa
     1681 gaactcgctg atacttgccc cctcacccta aattgtgaca ggattgagaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcact actaatctgg ccaacccagc gccactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc atcgatttcc tcgtgtacgc agaagccccc
     1861 gaggtcgaaa aggcgaagcg cgacttcccg ggccaacctg acatgtggaa aaacgctttt
     1921 agttctgatt tctcacacat aaaactggca ctggctccgc aaggtggctt tgataagaac
     1981 gggaacaccc cacacgggaa gggcgtcatg aagactctca ccactggctc cctcattgcc
     2041 cgggcatcag ggctgctcca cgagagattg gatgagtttg aactacaggg cccagctctc
     2101 accaccttca actttgaccg caacaaagtg cttgccttta gacagcttgc tgctgaaaac
     2161 aaatatgggt tgatggacac aatgaaagtt gggaggcagc tcaaggatgt caaaaccatg
     2221 ccagaactta aacaagcact caagaatatc tcaatcaaga agtgccagat tgtgtacagt
     2281 ggttgcacct acacacttga gtctgatggc aaaggcaatg tgaaagttga cagagtccag
     2341 agtacctccg ttcagactaa caatgagttg gctggcgccc tgcaccatct aaggtgcgcc
     2401 agaatcaggt attatgttaa gtgtgttcag gaggccctgt attctatcat ccagattgct
     2461 ggggctgcat ttgtcaccac gcgcatcatc aagcgtgtga acattcaaga cttatggtcc
     2521 aagccacaag tggaaaacac agaggaggct accagcaaag acgggtgccc aaaacccaaa
     2581 gatgatgagg agttcgtcat ttcatctgac gacattaaaa ctgagggtaa gaaggggaag
     2641 aacaagactg gccgtggtaa aaagcataca gccttctcaa gtaaaggtct cagtgatgaa
     2701 gagtatgatg agtacaagag aattagagag gaaagaaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gaccgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tcttcagacc aacaaggaaa
     2881 caacgcaagg aagaaagggc ttctctcggt ttagtcacag gttctgaaat taggaaaaga
     2941 aatccagaag acttcaagcc caaggggaaa ctatgggctg acgatgacag aagtgtggac
     3001 tacaatgaaa aactcagttt tgaggcccca ccaagcatct ggtcaaggat agtcaacttt
     3061 ggttcaggtt ggggcttctg ggtctccccc agcctgttca taacatcaac ccacgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaattcaggt gcacaagtca
     3181 ggcgaattct gtcgcttgag gttcccaaaa ccaatcagga ctgatgtgac tggcatgatc
     3241 ttggaagaag gtgcgcccga aggcaccgtg gtcacactac tcatcaaaag gcctactgga
     3301 gaactcatgc ccctagcagc tagaatggga acccacgcaa ccatgaaaat tcaagggcgc
     3361 actgttggag gtcagatggg catgcttctg acagggtcca acgccaaaag catggatcta
     3421 ggtaccacac caggtgattg cggctgtccc tacatctaca agagaggaaa cgactatgtg
     3481 gtcattggag tccacacggc tgccgctcgt gggggaaaca ctgtcatatg tgccacccag
     3541 gggggtgagg gggaagctac acttgaaggt ggtgacagta ggggaacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaaa ctcagcacca aaaccaaatt ctggagatca
     3661 tccacagcac cacttccacc tggcacctat gaaccagcct accttggtgg taaagacccc
     3721 agagtcaagg gtggcccctc gttgcagcaa gtcatgaggg accagctgaa accatttaca
     3781 gagcctaggg gtaagccacc aaagccaagt gtgttagaag ctgccaagaa aaccatcatc
     3841 aatgtccttg aacagacaat tgacccacct gagaagtggt cgttcgcaca agcttgcgcg
     3901 tcccttgata agaccacttc tagcggccat ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acaggtgcac ttaaggatga attagtcaaa
     4081 actgacaaaa tttatggcaa gatcaagaag aggcttctct ggggctcgga tttggcaacc
     4141 atgatccggt gtgctcgagc attcggaggt cttatggatg aactcaaagc acactgtgtc
     4201 acacttcctg tcagagttgg tatgaatatg aatgaggatg gccccatcat cttcgagaag
     4261 cattccaggt acagatacca ctatgatgct gattactctc ggtgggattc aacacaacag
     4321 agagccgtgc tggcagctgc tctagaaatc atggttaaat tctcctcaga accacatttg
     4381 gctcaggtag tagcagaaga ccttctttct cctagcgtag tggatgtggg tgacttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgcgcactc tccgaagtca caaatttgtc tccagacatc
     4561 atacaggcta attctctctt ctccttctat ggtgatgatg aaattgttag tacagacata
     4621 aaattagacc cagagaagtt gacagcaaag cttaaggaat atgggttgaa accaacccgc
     4681 cctgacaaaa ctgaagggcc tcttgttatt tctgaagact tagacggttt gacttttctg
     4741 cggagaactg tgacccgcga ccctgctggt tggtttggaa aactggagca gagctcaata
     4801 ctcaggcaaa tgtactggac taggggcccc aaccatgaag acccatctga atcaatgatc
     4861 ccacactctc aaagacccat acaattgatg tccttactgg gagaggccgc actccacggc
     4921 ccaacattct acagtaaaat cagcaagtta gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccaggca ggagccaatg ttcagatgga tgagattctc ggatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgaatga
     5101 cgccaaccca tctgatgggt ccgcagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgttgtcg gtgccgctat tgcggcgcct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa gtaactttgt acaagcccct ggtggagagt tcacagtatc
     5281 ccctagaaac gctccaggtg aaatactttg gagcgcgccc ttaggccctg atctgaatcc
     5341 ctacctatct catttggcca gaatgtataa tggttatgca ggtggttttg aagtgcagat
     5401 gatcctcgcg gggaacgcgt tcaccgcggg aaaaattata tttgcagcag tcccaccaaa
     5461 ttttccaact gaaggcttga gtcccagcca ggtcactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cttacctgat gttaggaata acttctatca
     5581 ctataaccag tcaaatgatc ctaccattaa attgatagca atgctgtata caccactcag
     5641 ggccaataat gccggggatg atgtcttcac agtctcttgt cgagtcctca cgaggccatc
     5701 ccctgatttt gacttcatat ttctggtgcc acctacagtt gagtcaagaa ctaaaccatt
     5761 tactgtccca gtcttgactg ttgaagaaat gaccaattca agattcccca ttcctttgga
     5821 gaaattgttc acgggtccca gcagtgcctt tgttgttcaa ccacaaaacg gcagatgcac
     5881 gactgatggc gtgctcttag gcaccaccca gctgtctcct gtcaacatct gcaccttcag
     5941 aggggatgtc acccacattg cgggttcccg taattacaca atgaatttgg cctctctaaa
     6001 ttggaacaat tatgacccaa cagaagagat tccagcccct ctgggaactc cagatttcgt
     6061 gggaaagatc caaggtgtgc tcactcaaac cacaaaggga gatggctcga cccggggcca
     6121 taaagctaca gtttacactg ggagtgccga cttcactcca aagctgggca gtgttcaatt
     6181 tggtactgat acagataatg actttgaaac tcaccaaaac acaagattta ccccagtcgg
     6241 tgtcatccag gatggtgcga ccacccaccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttattcagga agaaatgtcc ataatgtaca cctagcccct gctgtagccc ccaattttcc
     6361 gggcgaacaa cttcttttct tcaggtccac tatgcccgga tgcagcgggt atcccaacat
     6421 ggatttggat tgcctactcc cccaggagtg ggtgcaacac ttctaccaag aggcagctcc
     6481 agcacaatcc gatgtggctc tattgagatt tgtgaatcca gacacgggta gggtcttgtt
     6541 tgagtgcaaa ctccataaat caggctatgt cacagtggct cataccggcc aacatgattt
     6601 ggtcatcccc cccaatggtt attttaggtt tgattcctgg gttaatcagt tctacacact
     6661 tgcccccatg ggaaatggaa cggggcgcag acgtgcttta taatggctgg agctttcttt
     6721 gctggattgg catctgatgt ccttagctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggctatca accaaaagat tgattttgaa aataatagaa aattgcagca agcttccttt
     6841 cagtttagca gcaatctaca acaagcttcc tttcaacatg ataaagagat gctccaagca
     6901 caaattgagg ccactaaaaa gttgcaacag gaactgatga aagtcaaaca gacaatactc
     6961 ttagaaggtg gattttctga aacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaggctttgg actggagtgg gacaaggtac tgggcccctg atgctaggac tacaacatac
     7081 aatgcaggcc gcttttccac ccctcaacct tcgggggcac tgccaggaag aatcaatccc
     7141 aggactccta tccccgcccg gggctccccc agcatatctt ccaatgcttc tactgctact
     7201 tctatacatt caaatcaaac tgcttcaacg agacttggtt ctacagctgg ttctggcacc
     7261 aatgtctcga gtctcccgtc aactgcaagg actaggagtt gggttgagga tcaaaacaga
     7321 aatttgtcac ctttcatgag gggggctcac aacatatcgt ttgtcacccc accatctagc
     7381 agatcctcca gccaaggcac agtctcaacc gtgcctaaag atgttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcaca ttcgtaggcg aggggagtca
     7501 cgggtgtaa