Typing tool

Complete norovirus genomes

KC409317  GII.4 Den Haag
 GII.P4 Den Haag

Length: 7,511 | 3 CDS

ORF1: 3..5102
ORF2: 5083..6705
ORF3: 6705..7511
LOCUS       KC409317                7511 bp ss-RNA     linear   VRL 30-OCT-2013
DEFINITION  Norovirus Hu/GII/30257/2009/VNM, complete genome.
VERSION     KC409317.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII/30257/2009/VNM
  ORGANISM  Norovirus Hu/GII/30257/2009/VNM
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7511)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., My,P.V., Campbell,J.,
            Farrar,J., Vinh,H., Hoang,N.V., Wentworth,D.E. and Baker,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2012) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 263.8x
            Sequencing Technology    :: Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7511
                     /organism="Norovirus Hu/GII/30257/2009/VNM"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: F"
                     /country="Viet Nam: Ho Chi Minh City"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: II"
     gene            3..5102
     CDS             3..5102
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     3..992
                     /product="protein p48"
     mat_peptide     993..2090
     mat_peptide     2091..2627
                     /product="protein p22"
     mat_peptide     2628..3026
                     /product="viral genome-linked protein"
     mat_peptide     3027..3569
                     /product="3C-like protease"
                     /note="3CLpro; calcivirin"
     mat_peptide     3570..5099
                     /product="RNA-directed RNA polymerase"
     gene            5083..6705
     CDS             5083..6705
                     /product="capsid protein VP1"
     gene            6705..7511
     CDS             6705..7511
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 gaatgaagat ggcgtctaac gacgcttccg ctgccgctgt tgctaacagc aacaacgaca
       61 ccgcaaaatc ttcaagtgac aaaatgtttt ctaacatggc tgtcactttt aaacgagccc
      121 tcggggcgcg gcctaaacag ccccccccga gggaaatacc acaaagaccc ccacgaccac
      181 ctactccaga actggtcaaa aagatccctc ctcccccgcc caacggagag gatgaagcag
      241 tggtttctta tagtgccaaa gatggcgttt ccggtttacc tgagctttcc accgtcaggc
      301 aaccggaaga aaccaatacg gccttcagtg tccctccact caaccagagg gagaatagag
      361 atgctaagga acctctgact ggaacaattc tggaaatgtg ggatggagaa atctaccatt
      421 atggcctgta tgttgagcga ggtcttgtgc tgggtgtgca caaaccacca gctgccataa
      481 gcctcgccaa ggtcgaacta acaccactct ccttgttctg gagacctgtg tacactcccc
      541 agtacctcat ctctccagac actctcaaga aattacacgg agaaacgttt ccctacacag
      601 cctttgacaa caattgctat gccttttgtt gttgggtcct ggatctaaat gactcgtggc
      661 tgagtaggag aatgatccag agaacaactg gcttctttag accctaccaa gactggaata
      721 ggaaacccct ccccactatg gatgattcca agttaaagaa ggtagctaac atattcctgt
      781 gcgccctgtc ttcgctattc accaggccca taaaagacat aataggaaag ctaagacctc
      841 tcaacatcat caacatcctg gcttcatgtg attggacttt cgcaggcata gtggagtctt
      901 tgatactctt ggcagagctc tttggagtct tctggacacc cccagatgtg tctgcgatga
      961 ttgccccctt actcggtgat ttcgagttac aaggacctga ggaccttgta gtggagctcg
     1021 tccctgtagt aatgggggga attggtttgg tgttgggatt caccaaagag aagattggga
     1081 aaatgttgtc atctgctgca tccaccttga gagcttgtaa agatcttggt gcatatgggc
     1141 tagagatcct aaagttagtc atgaagtggt tcttcccgaa gaaagaggag gcaaatgaac
     1201 tggctatggt gagatccatc gaggatgcag tactggacct tgaggcaatt gaaaacaacc
     1261 atatgaccac cttgctcaaa gacaaagaca gcctggcaac ctacatgaga acccttgacc
     1321 tcgaggaaga gaaagccaga aaactctcaa ccaagtctgc ttcacctgac atcgtgggca
     1381 caattaacgc ccttctggcg agaatcgccg ctgcacgctc cctggtgcac cgagcgaagg
     1441 aggagctttc cagcagacca agacctgtag tcttgatgat atcaggcaga ccagggatag
     1501 gaaaaaccca ccttgctagg gaagtggcta agagaatcgc agcctccctc acaggagacc
     1561 agcgtgtagg cctcatccca cgcaatggcg tcgatcactg ggatgcgtac aagggggaga
     1621 gggtcgtcct atgggacgac tatggaatga gcaaccccat tcacgacgcc cttaggctgc
     1681 aagaactcgc tgacacttgc ccccttactc taaattgtga caggattgag aataaaggaa
     1741 aggtctttga cagcgatgtc atcattatca ccactaatct ggccaaccca gcaccactgg
     1801 actatgtcaa ctttgaagcg tgctcgaggc gcatcgattt cctcgtgtat gcagaagccc
     1861 ccgaggtcga aaaggcgaag cgtgacttcc cgggccaacc tgacatgtgg aaaaacgctt
     1921 ttagttctga tttctcacac ataaaattgg cactggctcc acaaggtggc tttgataaga
     1981 acgggaacac cccacacggg aagggcgtca tgaagactct caccactggc tccctcattg
     2041 cccgggcatc agggctgctc catgagagat tggatgagtt tgaactacag ggcccagctc
     2101 tcaccacctt caactttgat cgcaacaaag tacttgcctt cagacagctt gcagctgaaa
     2161 acaaatatgg gttgatagac acaatgaaag ttgggaggca gctcaaggat gtcaaaacca
     2221 tgccagaact taaacaagca ctcaaaaaca tctcaatcaa gaagtgccag attgtgtata
     2281 gtggttgcac ctacacactt gagtctgatg gcaagggcaa tgtgaaagtt gacagaatcc
     2341 agagcacctc cgtacagacc aacaatgagc ttgctggcgc cctgcatcat ctgaggtgcg
     2401 ccagaatcag atactatgtc aagtgtgtcc aggaggccct atattctatc atccagattg
     2461 ctggggccgc atttgtcacc acgcgcatta tcaagcgtgt gaacattcaa gacttatggt
     2521 ccaagccaca agtggaaaac acagaggagg ccaccaacaa ggacgggtgc ccaaaacccg
     2581 aagatgatga ggagttcgtc atttcatctg acgacattaa aactgagggt aagaaaggga
     2641 agaacaagac tggccgtggc aagaagcata cagccttttc aagtaaaggt ctcagtgatg
     2701 aagagtatga tgagtacaag agaattagag aggaaaggaa tggcaggtat tccatagaag
     2761 agtaccttca ggacagggac aaatactatg aggaggtggc cattgccagg gcgaccgagg
     2821 aagacttctg tgaagaggag gaggccaaga tccggcaaag gatctttaga ccaacaagga
     2881 aacaacgcaa ggaagaaaga gcttctctcg gtttagtcac aggttctgag attaggaaaa
     2941 gaaacccaga tgacttcaag cctaagggaa aactgtgggc tgacgatgac agaagtgtgg
     3001 actacaatga gaaactcagt tttgaggccc caccaagcat ctggtcaagg atagtcaact
     3061 ttggttcagg ttggggcttc tgggtctcac ctagcctgtt cataacatca acccacgtca
     3121 taccccaggg cgcaaaggag ttctttggag ttcccatcaa acaaattcag gtacacaagt
     3181 caggcgaatt ttgtcgcttg aggttcccaa aaccaatcag gactgacgtg actggcatga
     3241 tcttggaaga aggtgcgccc gaaggcaccg tggtcacact actcatcaaa aggtctactg
     3301 gagaactcat gcccctagca gctagaatgg ggacccatgc aaccatgaaa attcaagggc
     3361 gcaccgttgg aggtcagatg ggcatgcttc tgacaggatc caacgccaaa agcatggatc
     3421 taggcaccac accaggtgat tgcggctgtc cctacatcta caagagagga aatgactatg
     3481 tggtcattgg agtccatacg gctgccgctc gtgggggaaa cactgtcata tgtgccaccc
     3541 aggggggcga gggggaagct acacttgaag gtggtgacag taagggaaca tactgtggtg
     3601 caccaatcct aggcccaggg agtgccccaa aacttagcac caaaaccaaa ttctggagat
     3661 catccacagc accactccca cctggcacct atgaaccagc ataccttggt ggcaaggacc
     3721 ccagagtaaa gggtggccct tcgttgcagc aagtcatgag ggaccagctg aaaccattca
     3781 cagagcccag gggtaagcca ccaaagccaa gtgtgttaga agctgccaag aaaaccatca
     3841 tcaatgtcct tgaacaaaca attgacccac ctgagaggtg gtcgttcgca caagcttgcg
     3901 cctcccttga caagaccact tctagcggcc atccgcacca tatgcggaaa aacgactgct
     3961 ggaatgggga gtccttcaca ggcaagctgg cagaccaggc ttctaaggct aacctgatgt
     4021 ttgaagaagg gaagaacatg accccagtct acacaggtgc acttaaggat gaattagtca
     4081 aaactgacaa aatttatggt aagatcaaga agaggcttct ctggggctcg gatttagcaa
     4141 ccatgatccg gtgtgctcga gcattcggag gcctaatgga tgaactcaaa gcacactgtg
     4201 tcacacttcc cattagagtt ggtatgaata tgaatgagga tggccccatc atcttcgaga
     4261 agcattccag gtacagatac cactatgatg ctgattactc tcggtgggat tcaacacaac
     4321 agagagccgt gctggcagct gctctagaaa tcatggttaa attctcctca gaaccacatt
     4381 tggctcaggt agtcgcagaa gatcttcttt cccctagcgt ggtggatgtg ggtgatttca
     4441 caatatcaat caacgagggc cttccctctg gggtgccctg cacctcccaa tggaactcca
     4501 tcgcccactg gcttctcact ctttgtgcac tctccgaagt cacaaattta tccccagaca
     4561 tcatacaggc taattctctc ttctccttct atggtgatga tgaaattgtt agtacagaca
     4621 taaaattgga cccagagaag ttgacagcaa agcttaagga atatgggttg aaaccaaccc
     4681 gccctgacaa aactgaagga cctctcgtta tttctgaaga cttagatggt ttgactttcc
     4741 tgcggagaac tgtgacccgc gacccagctg gttggtttgg aaaactggag cagagctcaa
     4801 tactcaggca aatgtactgg actaggggcc ccaaccatga agatccatct gaatcaatga
     4861 ttccacactc tcaaagaccc atacaattga tgtccttact gggagaggcc gcactccacg
     4921 gcccaacatt ctacagtaaa atcagcaaat tagtcattgc agagctaaaa gaaggtggta
     4981 tggattttta cgtgcccagg caagagccaa tgttcagatg gatgagattc tcagatctga
     5041 gcacgtggga gggcgatcgc aatctggctc ccagttttgt gaatgaagat ggcgtcgaat
     5101 gacgccaacc catctgatgg gtccgcagcc aacctcgtcc cagaggtcag caatgaggtt
     5161 atggctttgg agcccgttgt cggtgccgct attgcggcgc ctgtagcggg ccaacaaaat
     5221 gtaattgacc cctggattag aaacaatttt gtacaagccc ctggtggaga gttcacagta
     5281 tcccctagaa acgctccagg tgaaatacta tggagcgcgc ccttaggccc tgatctgaat
     5341 ccctacctat ctcatttggc cagaatgtat aatggttatg caggtggttt tgaagtgcag
     5401 gtgatcctcg cggggaacgc gttcaccgcc ggaaaaatta tatttgcagc agtcccacca
     5461 aattttccaa ctgaaggcct gagtcccagc caagtcacta tgttccccca cataatagta
     5521 gatgttaggc aattggaacc tgtgttgatc cccttacctg atgttaggaa taacttctat
     5581 cattataatc agacaaatga tcctaccatt aaattgatag caatgctgta tacaccactt
     5641 agggccaata atgctgggga agatgtcttc acagtctctt gtcgagtcct cactaggccg
     5701 tcccctgatt ttgattttat atttttggtg ccacccacag ttgagtcaag aactaaacca
     5761 tttactgtcc caatcttaac cgttgaagaa atgaccaatt caagattccc catccctttg
     5821 gaaaagttgt tcacgggtcc cagcggtgcc tttgttgtcc aaccacaaaa tggcaggtgc
     5881 acgactgatg gcgtgctctt aggcaccacc caactgtctc ctgtcaacat ctgcaccttc
     5941 agaggggatg tcacccacat tgcaggttct cgtgattaca caatgaattt ggcatctcta
     6001 aattggaaca attatgaccc aacagaagaa attccagccc ctctgggaac tccagatttc
     6061 gtgggaaaga tccaaggtgt gctcactcaa accacaagag gagatggctc gacccgtggc
     6121 cataaagcta cagtttacac tgggagtgcc ccctttgctc caaaactggg cagtgttcaa
     6181 ttcagtactg acacagaaaa tgattttgaa actcaccaaa acacaaaatt caccccagtc
     6241 ggtgtcatcc aggatggtgg caccacccac cgaaatgaac cccaacaatg ggtgctccca
     6301 agttattcag gtagagatgt tcataatgta cacctagccc ctgctgtagc ccccactttt
     6361 ccgggtgaac aacttctttt cttcaggtcc actatgcccg gatgcagcgg gtatcccaac
     6421 atggatttgg attgcctact cccccaggag tgggtgcagc acttctacca agaggcagct
     6481 ccagcacaat ctgatgtggc tctattgaga tttgtgaatc cagacacggg tagggtcctg
     6541 ttcgagtgca aacttcataa atcaggctat gtcacagtgg ctcacaccgg tcagcatgat
     6601 ttggtcatcc cccctaatgg ctattttagg tttgattctt gggtcaatca gttctacacg
     6661 cttgccccca tgggaaacgg aacggggcgt aggcgcgcct tataatggct ggagctttct
     6721 ttgctggatt ggcatctgat gtccttggct ctggacttgg ttccctaatc aatgctgggg
     6781 ctggggccat caaccaaaag attgattttg aaaataatag aaaattgcag caagcttcct
     6841 tccagtttag cagtaatcta caacaggctt cctttcaaca cgataaagag atgcttcaag
     6901 cacaaattga ggccactaaa aagttgcaac aggaaatgat gaaagtcaaa caggcaatgc
     6961 tcctagaagg tggattctct gaaacagatg cagcccgtgg ggcaatcagc gcccccatga
     7021 caaaggtttt ggactggagc ggaacaaggt actgggcccc tgatgctagg accacaacat
     7081 acaattcagg ccgcttttcc accccccaac cttcggggac gctgccagga agaatcaatc
     7141 ccaggactcc tacccccgct cggggctcct ctagcacatc ttctaatgct tctactgcta
     7201 cttctataca tttaaatcaa actgtttcaa cgagacttgg ttctacagct ggttctggca
     7261 ccaatgtctc gagtctcccg tcaactgcaa ggactaggag ttgggttgag gatcaaaaca
     7321 gaaatttgtc acctttcatg aggggggctc ataacatatc gtttgtcacc ccaccatcta
     7381 gcagatcctc tagccaaggc acagtctcaa ccgtgcctaa agaaattttg gactcctggg
     7441 ctggcgcttt caacacgcgc aggcagcctc tcttcgctca cattcgtagg cgaggggagt
     7501 cacgggtgta a