Typing tool

Complete norovirus genomes

KC409311  GII.4 New Orleans
 GII.P4 Hunter

Length: 7,512 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KC409311                7512 bp ss-RNA     linear   VRL 13-MAR-2013
DEFINITION  Norovirus Hu/GII/30199/2009/VNM, complete genome.
VERSION     KC409311.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII/30199/2009/VNM
  ORGANISM  Norovirus Hu/GII/30199/2009/VNM
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7512)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., My,P.V., Campbell,J.,
            Farrar,J., Vinh,H., Hoang,N.V., Wentworth,D.E. and Baker,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2012) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 671.8x
            Sequencing Technology    :: Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7512
                     /organism="Norovirus Hu/GII/30199/2009/VNM"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: F"
                     /country="Viet Nam: Ho Chi Minh City"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: II"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calcivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caagtgacgg agtgctttct agcatggctg tcactttcaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaataccac aaagaccccc acgaccaccc
      181 actccagaac tgattaaaaa catcccccct cccccaccca acggagagga tgacatagtg
      241 gtctcttata atgttaaaga tggtgtctct ggtttgcctg atctttccac cgtcaggcaa
      301 ccagaagaat ccaacacggc cttcagtgtc cctccactca atcagaggga gaatagagat
      361 gctaaggagc cactgactgg aacaattctg gaaatgtggg atggagaaat ctaccattat
      421 ggcctgtatg tagagcgagg tcttgttcta ggtgtgcaca aaccaccagc tgccatcagc
      481 ctcgctaggg tcgaactaac accactttcc ttgtactgga gacctgtgta tactccccag
      541 tacctcatct ctccagacgc cctcaagaaa ctacacggag agacgttccc ctacacagcc
      601 tttgacaaca actgctatgc cttttgttgt tgggtcctgg acctaaacga ctcgtggctg
      661 agtaggagaa tgatccagag aacaactggc ttcttcagac cctaccaaga ttggaatagg
      721 aaacccctcc ccactatgga tgactccaag ttaaaaaagg tagctaacat attcctgtgt
      781 gcactgtctt cgctattcac caggcctata aaagatttaa tagggaagct aaggcccctt
      841 aacatcctca atatcttggc ctcatgtgat tggacttttg caggcatagt ggagtccttg
      901 atactcttgg cagaactctt cggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac tcggtgatta cgagctacaa ggacctgagg accttgcagt agagctcgtc
     1021 cctgtagtga tggggggaat tggtctggtg ctaggattca ccaaagagaa gattgggaaa
     1081 atgttgtcat ctgctgcatc caccttgaga gcttgtaaag atcttggtgc gtatgggcta
     1141 gagatcctga agttggtcat gaagtggttc ttcccgaaga aagaagaagc aaatgaactg
     1201 gctatagtga gatccatcga ggatgcagtc ctggatctcg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagt ctggcaacct acatgagaac ccttgacctt
     1321 gaggaggaga aagccaggaa actctcaacc aagtctgctt cacctgacat tgtgggcaca
     1381 atcaacgccc ttctagcgag aatcgctgct gcacgttctc tggtgcatcg agcgaaggag
     1441 gaactttcta gcagaccaag accggtggtg ttgatgatat caggcagacc aggaataggg
     1501 aagacccacc ttgctaggga agtggccaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtaggcc tcgtcccacg caatggcgtc gaccattggg atgcgtacaa gggggagagg
     1621 gtcgttctgt gggacgacta tggaatgagc aatcccatcc acgatgccct cagattgcaa
     1681 gaactcgctg acacttgtcc cctcacccta aactgtgaca ggattgagaa caaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcacc actaatctgg ctaacccagc accactggac
     1801 tacgtcaact ttgaagcatg ctcgaggcgc atcgacttcc tcgtgtatgc agaagcccct
     1861 gaggtcgaaa aggcgaagcg tgacttccca ggccaacccg acatgtggaa gaacgccttc
     1921 agttctgatt tctcacacat aaagctaaca ttggctccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacgggaa gggcgtcatg aagactctca ccaccggctc ccttattgcc
     2041 cgggcatcag ggctacttca tgagaggcta gatgaatttg aactacaggg cccaactctc
     2101 accaccttca actttgatcg caataaagtg cttgccttta gacaacttgc tgctgaaaac
     2161 aaatatgggt tgatggatac aatgaaagtt gggaggcagc tcaaggatgt cagaacaatg
     2221 ccagagctca agcaagcact caagaatact tcgatcaaga agtgccagat agtgtatagt
     2281 ggcagcacct acacacttga gtctgatggc aagggcaatg tgaaagttga cagagttcaa
     2341 agcacctccg tgcagaccaa caatgagctg gctggcgccc tacaccatct aaggtgcgcc
     2401 agaataagat actatgtcag gtgtgtccag gaggccctgt attccattat ccagattgct
     2461 ggggctgcgt ttgtcaccac gcgcatcgtc aagcgcatga acatacaaaa cttatggtct
     2521 aagccacaag tggaaaacac agaggagact accagcaagg acgggtgtcc aaaacccaaa
     2581 gatgatgaag agttcgtcat ttcatccgac gacatcaaaa ctgagggcaa gaaagggaaa
     2641 aacaagactg gtcgcggcaa gaaacacaca gccttctcaa gcaaaggtct cagtgatgaa
     2701 gagtacgatg aatacaagag gattagagaa gaaaggaacg gtaagtactc tatagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tcttcaggcc aacaaggaaa
     2881 caacgcaagg aggaaagagc ttctctcggt ttagttacag gttctgaaat taggaaaaga
     2941 aatccagatg atttcaaacc caaggggaaa ctgtgggctg acgatgacag aagtgtggac
     3001 tacaatgaga aactcagttt tgaagcccca ccaagcatct ggtcgagaat agtcagcttt
     3061 ggttcaggtt gggggttctg ggtctccccc agtttgttca taacatcaac ccatgtcata
     3121 ccccagggag caaaggagtt ctttggagtc cccatcaaac aaattcaggt acacaagtca
     3181 ggcgaattct gtcgcttgag attcccaaaa ccaatcagga ctgatgtgac gggcatgatc
     3241 ttagaagaag gtgcacccga gggcaccgtg gtcacactac tcatcaaaag gcccactgga
     3301 gagctcatgc ccttagcagc taggatgggg acccatgcaa ccatgaaaat ccaaggacgc
     3361 actgttggag gccagatggg catgcttctg acaggatcca acgccaaaag catggatctg
     3421 ggtactacac caggtgattg tggctgtccc tacatctaca agagaggaaa tgactatgtg
     3481 gtcattggag tccacacggc tgccgctcgc gggggcaaca ctgtcatatg tgccacccag
     3541 gggagtgagg gagaggctac acttgaaggt ggtgacaata aagggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaaa cttagcacca agaccaaatt ctggagatcg
     3661 tccacagcac cactcccacc tggcacttat gaaccagcct atcttggtgg caaggacccc
     3721 agagtcaagg gtggcccttc actgcagcag gtcatgaggg accagttgaa gccattcaca
     3781 gagcccaggg gcaagccacc aaagccaagt gtgttggaag ctgctaagaa aaccatcatc
     3841 aatgtccttg aacaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca agaccacctc cagtggccat ccgcatcaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacaga caagctggca gaccaggctt ccaaggctaa cctgatgttt
     4021 gaagaaggga agaacatgac gccagtctat acagctgcgc ttaaggacga attagttaaa
     4081 actgacaaaa tttatggcaa gatcaagaag aggcttctct ggggttcgga tttggcgacc
     4141 atgatccggt gtgctcgagc attcggaggt ctaatggacg aactcaaagc gcactgtgtc
     4201 acacttccca ttagagttgg tatgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cactctaggt acacatacca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agagccgtgc tggcagcagc tctagaaatc atggttaagt tctccccaga accacatttg
     4381 gcccaggtag tcgcagaaga ccttctttct cctagcgtgg tggacgtggg tgacttcaca
     4441 atatcaatta acgagggtct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc tcctcaccct ctgtgcgctc tctgaagtta caaatttgtc tcctgacacc
     4561 atacaagcta attccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagaaaagtt gacagcaaag ctcagggaat atgggttaaa gccaacccgc
     4681 cccgacaaaa ctgaaggacc ccttgtcatc tctgaagact tgaatggcct gactttcctg
     4741 cggagaactg taacccgcga cccagctggt tggtttggga aactggagca gagttcaata
     4801 cttaggcaaa tgtactggac taggggttcc aaccatgaag acccatctga aacaatgatt
     4861 ccacactccc aaagacccat acaactgatg tccctactgg gggaggccgc actccacggc
     4921 ccagcattct acagcaaaat cagcaagtta gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca agagccgatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa cctcgtccca gaggtcaaca atgaggttat
     5161 ggctttggag cccgttgttg gtgccgccat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa acaattttgt acaagcccct ggtggagagt tcacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atttgaaccc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 agtcctcgcg gggaacgcgt tcaccgccgg aaaaattata tttgcagcag tcccaccaaa
     5461 tttcccaact gaaggcttga gccccagcca ggtcaccatg ttcccccaca tgatagtaga
     5521 tgttaggcaa ttggaacctg tgttgatccc cctacccgat gttaggaata atttctatca
     5581 ctataaccaa tcaaatgacc ccaccatcaa attgatagca atgttgtata caccacttag
     5641 ggccaataat gctggggacg atgtcttcac agtctcttgt cgggttctca cgaggccatc
     5701 ccccgatttt gatttcatat ttttagtacc acccacagtt gagtcaagaa ctaaaccatt
     5761 ctctgtccca attttaactg ttgaggagat gaccaattca agattcccca ttcctttgga
     5821 aaagctgttc acgggtccca gcagtgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtaccaccca actgtctcct gtcaacatct gcactttcag
     5941 aggggatgtc acccatatta caggtagtca taactacaca atgaatttgg ctactcaaaa
     6001 ttggaacagt tatgacccaa cagaagaaat cccagcccct ctgggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcacccaaac cacaagggca gatggctcga cccgcggcca
     6121 caaagccaca gtgtacactg ggagcgccga ttttgctcca aaactgggta gagttcaatt
     6181 tgccactgac acaaacaatg atcttggtgc caaccaaaac acaaagttca ccccagtcgg
     6241 tgtcatccag gatggtggca ctgcccaccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggc agaaatagtc ataatgtgca cctggccccc gctgtagccc ccacttttcc
     6361 gggtgagcaa cttctcttct ttagatccac tatgcccgga tgcagcgggt accccaacat
     6421 ggatttggac tgtctgctcc cccaggaatg ggtgcagtat ttctatcaag aggcagcccc
     6481 agcacaatct gatgtggctc tgctaagatt tgtgaatcca gacacaggta gggttttgtt
     6541 tgagtgtaag cttcataaat caggctatgt tactgtggct cacactggcc aacatgattt
     6601 ggttatcccc cccaatggtt attttagatt tgattcctgg gtcaaccagt tctacacact
     6661 tgcccccatg ggaaatggaa cggggcgtag acgtgcgtta taatggctgg agctttcttt
     6721 gctggattgg catctgacgt cctgggctcc ggacttggtt ctctgatcaa tgccggggct
     6781 ggggccatca accaaaaagt tgaatttgaa aataacagaa aattgcaaca agcttccttc
     6841 caatttagca gcaatctaca acaggcttcc tttcagcatg ataaagagat gctccaagca
     6901 caaattgagg ccaccaaaaa gttgcaacag gaaatgatga gagttaaaca ggcaatgctc
     6961 ctagagggtg gattctctga gacagatgca gcccgtgggg caattaacgc ccccatgaca
     7021 aaggctttgg actggagtgg gacaaggtac tgggctcccg atgctaggac tacaacatac
     7081 aatgcaggcc acttttccac ccctcaatcc tcgggggcac tgccagggag agctaacctt
     7141 agggctgctg tccctgctcg aggctcctct agcacatctt ctaactcttc tactgctact
     7201 tctgtgtact caaatcaaac tatttcaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gcctcccgtc aactgcaagg actaggagct gggttgagga tcaaaatagg
     7321 aatttgtcac ctttcatgag gggggcccac aacatatcgt ttgtcacccc accatctagc
     7381 agaccctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca atacgcgcag gcagcctctc ttcgctcaca ttcgtaaacg aggggagtca
     7501 cgggcgtaat gt