Typing tool

Complete norovirus genomes

KC409302  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,533 | 3 CDS

ORF1: 5..5104
ORF2: 5085..6707
ORF3: 6707..7513
LOCUS       KC409302                7533 bp ss-RNA     linear   VRL 21-FEB-2013
DEFINITION  Norovirus Hu/GII/20477/2010/VNM, complete genome.
VERSION     KC409302.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII/20477/2010/VNM
  ORGANISM  Norovirus Hu/GII/20477/2010/VNM
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7533)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., My,P.V., Campbell,J.,
            Farrar,J., Vinh,H., Hoang,N.V., Wentworth,D.E. and Baker,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2012) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 343.7x
            Sequencing Technology    :: Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7533
                     /organism="Norovirus Hu/GII/20477/2010/VNM"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M"
                     /country="Viet Nam: Ho Chi Minh City"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: II"
     gene            5..5104
     CDS             5..5104
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     5..994
                     /product="protein p48"
     mat_peptide     995..2092
     mat_peptide     2093..2629
                     /product="protein p22"
     mat_peptide     2630..3028
                     /product="viral genome-linked protein"
     mat_peptide     3029..3571
                     /product="3C-like protease"
                     /note="3CLpro; calcivirin"
     mat_peptide     3572..5101
                     /product="RNA-directed RNA polymerase"
     gene            5085..6707
     CDS             5085..6707
                     /product="capsid protein VP1"
     gene            6707..7513
     CDS             6707..7513
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 gtgaatgaag atggcgtcta acgacgcttc cgctgccgct gttgctaaca gcaacaacga
       61 caccgcaaaa tcttcaagtg acggagtgct ttctagcatg gctgtcactt ttaaacgagc
      121 cctcggggcg cggcctaaac agcctccccc gagggaaaaa ccacaaagac ccccacgacc
      181 acctactcca gaactggtta aaaacattcc ccctccccca cccaacggag aggatgaaat
      241 agtggtttct tatagtgtca aagatggtgt ttccggcttg cctgaccttt ccaccgtcag
      301 gcaaccggaa gaatctaaca cggccttcag tgtccctcca ctcaatcaga gggagaatag
      361 agatgctaag gaaccactta ctgggacaat tctggaaatg tgggacgggg aaatctacca
      421 ttatggcctg tatgtggagc gaggtcttgt actaggtgtg cacaaaccac cagctgccat
      481 cagcctcgct agggttgagc tagcaccact ctccttgtac tggagacctg tgtacactcc
      541 tcagtacctc atctctccag acactctcaa gaaattatcc ggagaaacgt tcccctacac
      601 agcctttgac aacaactgtt atgccttttg ttgctgggtc ctggacctaa atgactcgtg
      661 gctgagcagg agaatgatcc agaggacaac tggtttcttc aggccctacc aagactggaa
      721 taggaaaccc cttcccacta tggatgactc caaaataaag aaggtagcta acatattcct
      781 gtgtgctctg tcctcgctgt tcaccagacc cataaaagat ataataggga agataaggcc
      841 tcttaacatc ctcaacatct tagcctcatg tgattggact tttgcaggta tagtggagtc
      901 cctgatactc ttggcagaac tctttggagt tttctggaca cccccagatg tgtctgcgat
      961 gattgccccc ttacttggtg actacgagct acaaggacct gaggaccttg cagttgagct
     1021 cgtccccgtg gtgatggggg gaattggttt ggtgctagga ttcaccaaag agaagattgg
     1081 gaaaatgttg tcatctgctg cgtctacctt gagagcttgt aaagaccttg gtgcatatgg
     1141 gctagagatc ctaaagttgg tcatgaagtg gttcttcccg aagaaggaag aggcaaatga
     1201 gctggctata gtgaggtcta tcgaggatgc agtcctggac ctcgaggcaa ttgaaaacaa
     1261 ccatatgacc accttgctca aagacaaaga cagtctggca acctatatga gaacacttga
     1321 ccttgaggag gagaaagcca ggaaactctc aaccaagtct gcctcacccg acatcgtggg
     1381 cacaatcaac gccctcctgg cgagaatcgc tgccgcacgt tctctggtgc accgagcgaa
     1441 ggaggagctt tccagcagac caagacctgt ggtgttgatg atatcaggca ggccaggaat
     1501 agggaagacc cacctcgcta gggaagtggc taagagaatc gcagcctccc ttacaggaga
     1561 ccagcgtgtg ggcctcatcc cacgcaatgg cgtcgaccat tgggatgcgt acaaggggga
     1621 gagggtcgtc ctatgggacg attatggaat gagcaaccct attcacgatg ccctcaggct
     1681 gcaagaactc gctgacactt gccccctcac tctaaactgt gacaggatcg aaaataaagg
     1741 aaaggtcttt gacagcgatg tcatcattat caccactaat ctggccaacc cagcgccact
     1801 ggactatgtc aactttgaag catgctcgag gcgcatcgac ttcctcgtgt atgcagaagc
     1861 ccctgaagtc gaaaaggcga agcgtgactt cccaggccag cctgacatgt ggaagaacgc
     1921 tttcagttct gatttctcac acataaaact agcactggcc ccacagggtg gtttcgacaa
     1981 gaacgggaac accccacacg gaaagggcgt tatgaagact ctcaccactg gctcccttat
     2041 tgcccgggca tcagggctac tccatgagag attggatgaa ttcgaactgc agggcccagc
     2101 tctcaccacc ttcaatttcg atcgcaataa ggtgcttgcc tttagacagc ttgctgctga
     2161 aaataaatat ggattgatgg acacaatgag agttgggaaa cagctcaagg atgtcagaac
     2221 catgccagaa ctcaaacaag cactcaagaa tgtctcaatc aagaagtgcc aaatagtgta
     2281 tagtggttgc acctacatac ttgagtctga tggcaagggc agtgtgaaag ttgacagaat
     2341 ccaaagcgcc gccgtgcaga ccaacaatga gctggctggt gccctgcacc atttgaggtg
     2401 cgccagaatc agatactatg tcaagtgtgt ccaggaggcc ctgtattcca tcattcaaat
     2461 tgctggggct gcatttgtca ccacgcgcat tgccaagcgc atgaacatac aagacctatg
     2521 gtccaagcca caagtggaaa acacagagga gactaccagc aaggacgggt gcccaaaacc
     2581 taaggacgat gaggagtttg tcatttcatc cgacgacatc aaaactgagg gtaagaaagg
     2641 gaagaacaag actggccgcg gcaagaagca cacagcattt tcaagcaaag gcctcagtga
     2701 tgaagagtac gatgagtaca agaggattag agaagaaagg aatggcaagt actccataga
     2761 agagtacctt caggacaggg acaaatacta tgaggaggtg gccattgcca gggcgactga
     2821 ggaagacttc tgtgaagagg aggaggccaa gatccggcaa aggatcttta ggccaacaag
     2881 gaaacaacgc aaggaggaaa gagcctctct cggtctggtc acaggctctg aaattaggaa
     2941 aagaaaccca gatgacttca aacccaaagg gaaattgtgg gctgacgatg acaggagtgt
     3001 ggactacaat gagaaactca gttttgaggc cccaccaagc atctggtcga gaatagtcaa
     3061 ctttggttca ggctggggat tttgggtctc ccccagtctg ttcataacat caacccatgt
     3121 cataccccag ggcgcaaagg agttctttgg agtccccatc aaacaaatac aggtacacaa
     3181 gtcaggcgag ttctgtcgct tgagattccc aaaaccaatc aggactgatg tgacgggcat
     3241 gatcttagaa gaaggcgcac ctgagggcac tgtggtcaca ctactcatca aaaggtccac
     3301 tggggaactc atgcccctag cagctagaat gggaacccat gcgaccatga agatccaagg
     3361 gcgcactgtt ggaggccaga tgggcatgct tctgacagga tccaacgcca agagcatgga
     3421 cctgggtact acaccaggtg attgtggctg cccctatatc tacaagagag gtaatgacta
     3481 tgtggttatt ggggttcaca cggctgccgc acgtgggggg aacactgtca tatgtgccac
     3541 ccaggggagt gaaggagagg ctacacttga aggtggtgac aacaagggga catactgtgg
     3601 tgcaccaatc ctaggcccag ggagtgcccc aacacttagc accaagacca aattctggag
     3661 atcgtccaca gcatcactcc cacctggcac ctatgaacca gcctatcttg gtggtaagga
     3721 ccctagggtc aagggtggcc cttcactgca gcaagtcatg agggaacagt tgaagccatt
     3781 cacagagccc aggggcaagc caccaaaacc aagtgtatta gaagctgcca agaagaccat
     3841 catcaatgtc cttgagcaaa caattgatcc acctgagaaa tggtcgttcg cacaagcttg
     3901 cgcgtccctt gacaagacca cttccagtgg tcatccgcac cacatgcgga aaaacgactg
     3961 ctggaacggg gagtccttca caggcaagct ggcagaccag gcttccaagg ccaacctgat
     4021 gtttgaagaa gggaagaaca tgaccccagt ctacacagct gcgctcaagg atgagttggt
     4081 taaaactgac aaaatttatg gtaagatcaa gaagaggctt ctctggggct cggacttggc
     4141 gaccatgatc cggtgtgctc gagcattcgg aggcctaatg gatgaactca aggcacactg
     4201 tgtcacactt cccattagag ttggcatgaa tatgaatgag gatggcccca tcatcttcga
     4261 gaggcattcc aggtacacat atcactatga tgctgattac tctcgatggg attcaacaca
     4321 acagagagcc gtgttggcag cagctctaga aatcatggtt aaattctccc cagaaccaca
     4381 cttggctcag gtagtcgcgg aggaccttct ttctcctagc gtggtggacg tgggcgactt
     4441 cacaatatca atcaacgagg gtcttccctc tggggtaccc tgcacctccc aatggaactc
     4501 catcgcccac tggcttctca ctctctgcgc gctctctgaa gtcacaaacc tgtcccctga
     4561 taccatacag gctaactccc tcttctcttt ttatggtgat gatgaaattg ttagtacaga
     4621 cataaaattg gacccagaaa aattgacagc aaagctcaga gaatatgggt taaaaccaac
     4681 ccgccctgac aaaactgaag ggccccttgt catctctgaa gacctgaatg gcctaacttt
     4741 cctgcggaga actgtgaccc gcgacccagc tggttggttt ggaaaactgg agcagagttc
     4801 aatactcagg caaatgtact ggactagggg tcccaaccat ggagacccat ctgaaacaat
     4861 gattccacac tcccaaagac ccatacaatt gatgtcccta ctgggggagg ccgcactcca
     4921 cggcccagca ttttacagca aaatcagcaa attagtcatt gcagagctaa aagaaggtgg
     4981 catggatttt tacgtgccca gacaagagcc aatgttcaga tggatgagat tctcagatct
     5041 gagcacgtgg gagggcgatc gcaatctggc tcccagtttt gtgaatgaag atggcgtcga
     5101 gtgacgccaa cccatctgat gggtccacag ccaaccttgt cccagaggtc aataatgagg
     5161 ttatggcttt ggagcccgta gttggtgccg ccattgcggc acctgtagcg ggccaacaaa
     5221 atgtaattga cccctggatt agaaacaatt ttgtacaagc ccctggtgga gagtttacag
     5281 tatcccctag aaacgctcca ggtgaaatac tatggagcgc gcccttaggc cctgatttga
     5341 atccctacct ttcccatttg gccagaatgt acaatggtta tgcaggtggt tttgaagtgc
     5401 aggtaatcct cgcggggaac gcgttcaccg ccgggaaaat catatttgca gcagtcccac
     5461 caaatttccc aactgaaggt ttgagcccca gccaggtcac tatgttcccc cacataatag
     5521 tagatgttag gcaattggaa cctgtgttga ttcccttacc cgatgttagg aataatttct
     5581 accattataa tcaatcaaat gaccccacca tcaaattgat agcaatgttg tacacaccac
     5641 ttagggctaa taatgccggg gacgatgtct tcacagtttc ttgtcgagtt ctcacgagac
     5701 catcccccga ttttgatttc atatttttgg tgccacccac agttgaatca agaactaaac
     5761 cattctctgt cccagtttta actgttgagg agatgaccaa ttcaaggttc cccattcctt
     5821 tggaaaagtt gttcacgggc cccagtagtg cctttgttgt tcaaccacaa aacggcaggt
     5881 gcacgactga tggcgtgctc ctaggtacta cccaactgtc tcccgtcaac atctgcacct
     5941 tcagagggga cgtcacccat attccaggca gccgtaacta cacaatgaat ttggcctccc
     6001 aaaattggaa cagttacgat ccaacagaag aaatcccagc ccctctagga actccagatt
     6061 tcgtggggaa gattcaaggt gtgctcaccc aaaccacaag gacaaatggc tcgacccgcg
     6121 gccacaaagc tacagtgtac actgggagcg ccgacttttc tccaaaactg ggtagagttc
     6181 aatttgccac tgacacagac aatgattttg aaattaacca aaacacaaag ttcaccccag
     6241 tcggtgttat ccaggatggt agtaccaccc cccgaaatga accccaacaa tgggtgctcc
     6301 caagttactc aggcagaaac attcataatg tgcacctggc ccccgctgta gcccccactt
     6361 tcccgggcga gcagctcctc ttcttcagat ctactatgcc cggatgcagc gggtacccca
     6421 acatggactt ggactgtctg ctcccccagg aatgggtgca atatttctac caggaggcag
     6481 ccccagcaca atctgatgtg gctctgctaa gatttgtgaa tccggacaca ggtagggttt
     6541 tgtttgagtg taagcttcat aaatcaggct atgttacagt ggctcacact ggccaacatg
     6601 atttggttat cccccccaat ggttatttta gatttgattc ctgggtcaac cagttctaca
     6661 cacttgcccc catgggaaat gggacggggc gtagacgtgc attataatgg ctggagcttt
     6721 ctttgctgga ttggcatctg acgtccttgg ctctggactt ggttccctaa tcaatgctgg
     6781 ggctggggcc atcaatcaaa aagttgaatt tgaaaataac agaaaattgc aacaagcttc
     6841 cttccaattt agtagtaatc tacaacaggc ttcctttcaa catgacaaag agatgctcca
     6901 agcacaaatt gaggccacca aaaagttgca acaggaaatg atgagagtta aacaagcaat
     6961 gctcctagag ggtggattct ctgagacaga tgcagcccgt ggggcaatca atgcccccat
     7021 gacaaaaact ttggactgga gcgggacaag gtactgggct cccgatgcta ggactacaac
     7081 atataatgca ggccgctttt ccacccccca accctcgggg gcactaccag gaagagctaa
     7141 tcttagggct actgtccccg cccggggttc ctccagcacg ttctctaact cttctattgc
     7201 tacttctgtg tattcaaatc aaaccacctc aacgagactt ggttctacag ctggttctgg
     7261 taccagtgtc tcgagcctcc cgtcaactgc aaggactagg agctgggttg aggatcaaaa
     7321 taggaatttg tcacctttca tgaggggggc ccataacatc tcgtttgtca ccccaccatc
     7381 tagcagatcc tctagccaag gcacagtctc aaccgtgccc aaagaagttt tggactcctg
     7441 gactggcgct ttcaacacgc gcaggcagcc tctcttcgct cacattcgca agcgagggga
     7501 gtcacgggtg taatgtgaaa agacaaaatt gat