Typing tool

Complete norovirus genomes

KC409278  GII.4 Den Haag
 GII.P4 Den Haag

Length: 7,511 | 3 CDS

ORF1: 3..5102
ORF2: 5083..6705
ORF3: 6705..7511
LOCUS       KC409278                7511 bp ss-RNA     linear   VRL 13-MAR-2013
DEFINITION  Norovirus Hu/GII/20208/2009/VNM, complete genome.
VERSION     KC409278.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII/20208/2009/VNM
  ORGANISM  Norovirus Hu/GII/20208/2009/VNM
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7511)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., My,P.V., Campbell,J.,
            Farrar,J., Vinh,H., Hoang,N.V., Wentworth,D.E. and Baker,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2012) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 387.5x
            Sequencing Technology    :: Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7511
                     /organism="Norovirus Hu/GII/20208/2009/VNM"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M"
                     /country="Viet Nam: Ho Chi Minh City"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: II"
     gene            3..5102
     CDS             3..5102
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     3..992
                     /product="protein p48"
     mat_peptide     993..2090
     mat_peptide     2091..2627
                     /product="protein p22"
     mat_peptide     2628..3026
                     /product="viral genome-linked protein"
     mat_peptide     3027..3569
                     /product="3C-like protease"
                     /note="3CLpro; calcivirin"
     mat_peptide     3570..5099
                     /product="RNA-directed RNA polymerase"
     gene            5083..6705
     CDS             5083..6705
                     /product="capsid protein VP1"
     gene            6705..7511
     CDS             6705..7511
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 gaatgaagat ggcgtctaac gacgcttccg ctgccgctgt tgctaacagc aacaacgaca
       61 ccgcaaaatc ttcaagtgac aaaatgtttt ctagcatggc tgtcactttt aaacgagccc
      121 tcggggcgcg gcctaaacag cctcccccga gggaaatacc gcaaagaccc ccacgaccac
      181 ctactccaga actggtcaaa aaggtccctc ctcccccgcc caacggagag gatgaagtag
      241 tggtttctta tagtgccaaa gatggcattt ccggtctacc tgagctttcc accgtcagac
      301 aaccagaaga aaccaatacg gccttcagtg tccctccact caatcagagg gagaataggg
      361 atgctaagga accactgact ggaacaattc tggaaatgtg ggatggagaa atctatcatt
      421 atggcctgta tgttgaacga ggtcttgtgc tgggtgtgca caaaccacca gctgccatta
      481 gcctcgccaa ggtcgaacta acaccactct ccttgttctg gagacctgtg tacaccccac
      541 agtacctcat ctctccagac actctcaaga aattacacgg agaaacattt ccctacacag
      601 cctttgacaa caactgctat gccttctgtt gctgggtcct ggatctaaac gactcgtggc
      661 tgaataggag aatgatccag agaacaactg gcttcttcag accctaccaa gactggaata
      721 ggaaacccct ccctactacg gatgattcca aattaaagaa ggtagctaac atattcctgt
      781 gcaccctgtc ttcgctattc accaggccca taaaagacat aatagggaag ttaaggcctc
      841 tcaacatcat caacatcctg gcttcatgtg attggacttt cgcaggcatc gtggagtcct
      901 tgatactctt ggcagagctc tttggagtct tctggacacc cccagatgtg tctgcgatga
      961 ttgccccctt actcggtgat ttcgagttac aaggacctga ggaccttgta gtggagctcg
     1021 tccctgtggt aatgggggga attggtttgg tgctgggatt caccaaagag aagattggaa
     1081 aaatgttgtc atctgctgca tccaccttga gagcttgtaa agatctcggt gcatatgggc
     1141 tagagatcct aaagttagtc atgaagtggt tcttcccgaa gaaagaggag gcaaatgaac
     1201 tggctatggt gagatccatc gaggatgcag tactggacct tgaggcaatt gaaaacaacc
     1261 atatgaccac cttactcaaa gataaagaca gcctggcaac ctacatgaga acccttgacc
     1321 tcgaggaaga gaaagccaga aaactctcaa ccaagtctgc ttcacctgac atcgtgggca
     1381 caatcaacgc ccttctggcg agaatcgccg ctgcacgctc cctggtgcac cgagcgaagg
     1441 aggagctttc cagcagacca agacctgtgg tcttgatgat atcaggtaga ccagggatag
     1501 ggaagaccca ccttgctagg gaagtggcta agagaatcgc agcctccctc acaggagacc
     1561 agcgcgtagg cctcatccca cgcaatggcg tcgatcactg ggatgcgtac aagggggaga
     1621 gggtcgtcct atgggacgac tatggaatga gcaatcccat ccacgacgcc ctcaggctgc
     1681 aagaactcgc tgacacttgc cccctcactc taaattgtga caggattgag aataaaggaa
     1741 aggtctttga cagcgatgtc atcattatca ctactaatct ggccaaccca gcaccactgg
     1801 actatgtcaa ctttgaagcg tgctcgaggc gcatcgattt cctcgtgtac gcagaagccc
     1861 ccgaggtcga aaaggcgaag cgtgacttcc cgggccaacc tgacatgtgg aaaaacgctt
     1921 ttagttctga tttctcacac ataaaattgg cactggctcc acaaggtggc ttcgataaga
     1981 acgggaacac cccacacggg aagggcgtca tgaagactct caccactggc tcccttattg
     2041 cccgggcatc agggctgctc catgagagat tggatgagtt tgaactacag ggcccagctc
     2101 tcaccacctt caactttgac cgcaacaaag tgcttgcctt caggcagctt gctgctgaaa
     2161 acaaatacgg gttgatggac acaatgagag ttgggaggca gctcaaggat gtcaaaacca
     2221 tgccagaact taaacaagca ctcaagagca tctcaatcaa gaagtgtcag attgtgtaca
     2281 gtggttgcac ctacacactt gagtctgatg gcaagggcaa tgtgaaggtc gacagagttc
     2341 agagcacctc cgtacagacc aacaatgagc tggctggcgc cctgcaccat ctgaggtgcg
     2401 ccagaatcag gtactatgtt aagtgtgtcc aggaggccct gtattctatc attcagattg
     2461 ctggggctgc atttgtcacc acgcgcatca tcaagcgtgt gaacattcaa gacttatggt
     2521 ccaagccaca agtggaaaac acagaggaag ccaccaacaa ggacgggtgc ccaaaaccca
     2581 aagatgatga ggagttcgtc attacatctg acgacattaa aactgagggt aagaaaggaa
     2641 agaacaagac tggccgtggt aagaagcaca cagccttctc aagtaaaggt ctcagtgatg
     2701 aagagtatga tgagtacaag agaattagag aggaaaggaa tggtaaatac tccatagaag
     2761 agtaccttca ggacagggac aaatactatg aggaggtggc cattgccagg gcgaccgagg
     2821 aagacttctg tgaagaggag gaggccaaga tccggcaaag gatcttcaga ccaacaagga
     2881 aacaacgcaa ggaagaaaga gcttctctcg gtttagtcac aggttctgaa attaggaaaa
     2941 gaaacccaga tgacttcaag cccaagggga aactatgggc tgacgatgac agaagtgtgg
     3001 actacaatga gaaactcagt tttgaggctc cgccaagcat ctggtcaagg atagtcaact
     3061 ttggctcagg ttggggcttc tgggtctccc ccagcctatt cataacatca acccacgtca
     3121 taccccaggg cgcaaaggag ttctttggag tccccatcaa acaaattcag gtgcacaagt
     3181 caggcgaatt ctgtcgcttg aggttcccaa aaccaatcag gactgatgtg actggcatga
     3241 tcttggaaga aggcgcgcct gaaggcaccg tggccacact actcatcaaa aggtctactg
     3301 gagaactcat gcccctagca gccagaatgg ggacccatgc aaccatgaag attcaagggc
     3361 gcactgttgg aggtcagatg ggcatgcttc tgacaggatc caacgccaaa agcatggatc
     3421 taggcaccac accaggtgat tgcggctgtc cctacatcta caagagagga aatgactatg
     3481 tggtcattgg agtccacacg gctgccgctc gtgggggaaa cactgtcata tgtgccaccc
     3541 agtggggtga gggggaagct acacttgaag gtggtgacag taagggaacg tactgtggtg
     3601 cgccaatcct aggcccaggg agcgccccaa aacttagcac caaaaccaaa ttctggagat
     3661 catccacagc accactccca cctggcacct atgagccagc ctaccttggt ggcaaggacc
     3721 ccagggtcaa gggtggcccc tcgctgcagc aagtcatgag agaccagctg aaaccattca
     3781 cagagcccag gggtaagcca ccaaagccaa gtgtgttaga agctgccaag aaaaccatca
     3841 tcaatgttct tgaacaaaca attgacccac ctgagaagtg gtcgttcgca caggcttgcg
     3901 cgtcccttga caagaccact tctagcggcc atccgcacca catgcggaaa aacgactgct
     3961 ggaacgggga gtccttcaca ggcaggctgg cagaccaggc ttccaaggcc aacctgatgt
     4021 ttgaagaagg gaagagcatg accccagttt acacaggtgc gctcaaggat gagttagtca
     4081 aaactgacaa aatttatggc aagatcaaga agaggcttct ctggggctcg gatttagcaa
     4141 ccatgatccg gtgtgctcga gcattcggag gcctaatgga tgaactcaaa gcacactgtg
     4201 tcacacttcc tatcagagtt ggtatgaata tgaatgagga tggccccatc atcttcgaga
     4261 agcactccag gtacaggtac cactatgatg ctgattactc tcggtgggat tcaacacaac
     4321 agagagccgt gctggcagct gctctagaaa ttatggttaa attctcctca gaaccacatt
     4381 tggctcaggt ggtcgcagaa gaccttcttt ctcctagcgt ggtggatgtg ggtgacttca
     4441 caatatcaat caatgagggt cttccctctg gggtgccctg cacttcccaa tggaactcca
     4501 tcgcccactg gcttctcact ctatgtgcac tctccgaagt tacaaatttg tccccagaca
     4561 tcatacaggc taattctctc ttctccttct atggtgatga tgaaattgtt agtacagaca
     4621 taaaactaga cccagagaag ttgacagcaa agcttaagga atatgggtta aaaccaaccc
     4681 gccctgataa aactgaagga cctcttgtta tttctgaaga cttagatggt ttgactttcc
     4741 tgcggagaac tgtgacccgc gacccagctg gttggtttgg aaaactggag cagagctcaa
     4801 tactcaggca aatgtactgg accaggggcc ccaaccatga agatccatct gaatcaatga
     4861 taccacactc tcaaagaccc atacaattga tgtccctact gggagaggcc gcactccacg
     4921 gcccaacatt ctatagtaaa atcagcaaat tagtcattgc agagctaaaa gaaggtggta
     4981 tggattttta cgtgcccagg caagagccaa tgttcagatg gatgagattc tcagatctga
     5041 gcacgtggga gggagatcgc aatctggctc ccagctttgt gaatgaagat ggcgtcgaat
     5101 gacgccaacc catctgatgg gtccgcagcc aacctcgtcc cagaggtcaa caatgaggtt
     5161 atggctttgg agcccgttgt cggtgccgct attgcggcgc ctgtagcggg ccagcaaaat
     5221 gtaattgacc cctggattag gaataatttt gtacaagccc ctggtggaga gttcacagta
     5281 tcccctagaa acgctccagg tgaaatacta tggagcgcgc ccttaggccc tgatctgaat
     5341 ccctacctat ctcatttggc cagaatgtat aatggttatg caggtggctt tgaagtgcag
     5401 gtgatcctcg cggggaacgc gttcaccgcc ggaaaaatta tattcgcagc agttccacca
     5461 aattttccaa ctgaaggctt gagccccagc caggttacta tgttccccca cataatagta
     5521 gatgttaggc aactggaacc tgtgttgatc cccttacctg atgttaggaa taacttctat
     5581 cattataatc agtcaaatga ttctaccatt aagttgatag caatgctgta cacaccactt
     5641 agggctaata atgctgggga agatgtcttc acagtctctt gtcgagtcct cacgaggcca
     5701 tcccctgatt ttgattttat atttttggtg ccacctacag ttgagtcaag aactaaacca
     5761 tttactgtcc caatcttaac tgttgaagaa atgaccaatt caagattccc catccctttg
     5821 gaaaagttgt tcacgggccc cagcggtgcc tttgttgttc aaccgcaaaa tggtaggtgc
     5881 acgactgatg gcgtgctctt aggcaccacc caactgtctc ctgtcaacat ctgcaccttc
     5941 agaggggatg tcacccacat tgcaggttct cgcaattaca cgatgaattt ggcttctcta
     6001 aattggaaca attatgaccc aacagaagaa attccagccc ctctgggaac tccagatttc
     6061 gtgggaaaga tccaaggtgt gctcactcaa accacaaagg gagatggctc gacccgtggc
     6121 cataaagcta cagtttacac tgggagtgcc ccctttactc caaagctggg cagtgtccaa
     6181 ttcagcactg atacagaaaa tgattttgaa gctcaccaaa acacaaaatt caccccagtc
     6241 ggtgtcatcc aggatggtgg caccacccac cgaaatgaac cccaacaatg ggtgctccca
     6301 agctattcag gtagagatgt ccacaatgta cacctggccc ctgctgtagc ccccactttt
     6361 ccgggtgaac aacttctttt cttcaggtcc actatgcccg gatgcagtgg gtatcccaac
     6421 atggatttgg attgcctact cccccaggag tgggtgcagc acttctacca agaggcagct
     6481 ccagcacaat ctgatgtggc tctattgaga tttgtgaatc cagacacggg tagggtcctg
     6541 tttgagtgca aacttcataa atcaggctat gtcacagtgg ctcacactgg ccagcatgat
     6601 ttggtcatcc cccccaatgg ctattttagg tttgattcct gggttaatca attctacaca
     6661 cttgccccca tgggaaatgg aacggggcgt agacgtgctt tataatggct ggggctttct
     6721 ttgctggatt ggcatctgat gtccttggct ctggacttgg ctccctaatc aatgctgggg
     6781 ctggggctat caaccaaaag attgattttg aaaataacag aaaattgcag caagcttcct
     6841 tccagtttag cagtaatcta caacaggcct cctttcaaca tgacaaagag atgctccaag
     6901 cacaaattga ggccactaaa aagttgcaac aggaaatgat gaaagtcaaa caggcaatgc
     6961 tcttagaagg tgggttctct gaaacagatg cagctcgtgg ggcaatcaac gcccccatga
     7021 caaaggtttt ggactggagc ggaacaaggt actgggcccc tgatgctagg actacaacat
     7081 acaatgcagg ccgcttttcc gcccctcaac cctcggggtc attgccagga agaatcaatc
     7141 ccagggctcc tacccccgct cgggtctcct ccagtacatc ctctaatgct tctactgtta
     7201 cttctatata ttcaaatcaa actgtttcaa cgagacttgg ttctacagct ggctctggca
     7261 ccaatgtctc gagtctcccg tcaactgcaa ggactaggag ttgggttgag gatcaaaaca
     7321 gaaatttgtc acctttcatg aggggggctc acaacatatc gtttgtcacc ccaccatcta
     7381 gcagatcctc tagccaaggc acagtctcaa ccgtgcctaa agaagttttg gactcctgga
     7441 ctggcgcttt caacacgcgc aggcagcctc tcttcgctca cgttcgtagg cgaggggagt
     7501 cacgggtgta a