Typing tool

Complete norovirus genomes

KC409242  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,509 | 3 CDS

ORF1: 1..5100
ORF2: 5081..6703
ORF3: 6703..7509
LOCUS       KC409242                7509 bp ss-RNA     linear   VRL 13-MAR-2013
DEFINITION  Norovirus Hu/GII/10406/2010/VNM, complete genome.
VERSION     KC409242.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII/10406/2010/VNM
  ORGANISM  Norovirus Hu/GII/10406/2010/VNM
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7509)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., My,P.V., Campbell,J.,
            Farrar,J., Vinh,H., Hoang,N.V., Wentworth,D.E. and Baker,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2012) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 395.0x
            Sequencing Technology    :: Sanger; Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7509
                     /organism="Norovirus Hu/GII/10406/2010/VNM"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M"
                     /country="Viet Nam: Ho Chi Minh City"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: II"
     gene            1..5100
     CDS             1..5100
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     1..990
                     /product="protein p48"
     mat_peptide     991..2088
     mat_peptide     2089..2625
                     /product="protein p22"
     mat_peptide     2626..3024
                     /product="viral genome-linked protein"
     mat_peptide     3025..3567
                     /product="3C-like protease"
                     /note="3CLpro; calcivirin"
     mat_peptide     3568..5097
                     /product="RNA-directed RNA polymerase"
     gene            5081..6703
     CDS             5081..6703
                     /product="capsid protein VP1"
     gene            6703..7509
     CDS             6703..7509
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 atgaagatgg cgtctaacga cgcttccgct gccgctgttg ctaacagcaa caacgacacc
       61 gcaaaatctt caagtgacgg agtgctttct agcatggctg tcacttttaa acgagccctc
      121 ggggcgcggc ctaaacagcc tcccccgagg gaaaaaccac aaagaccccc acgaccacct
      181 actccagaac tggttaaaaa cattccccct cccccaccca acggagagga tgaaatagtg
      241 gtttcttata gtgtcaaaga tggtgtttcc ggcttgcctg acctttccac cgtcaggcaa
      301 ccggaagaat ctaacacggc cttcagtgtc cctccactca atcagaggga gaatagagat
      361 gctaaggaac cacttactgg aacaatcctg gaaatgtggg acggggaaat ctaccattat
      421 ggcctgtatg tggagcgagg tcttgtacta ggtgtgcaca agccaccagc tgccatcagc
      481 ctcgctaggg ttgagctagc accactctcc ttgtactgga gacctgtgta cactcctcag
      541 tacctcatct ctccagacac tctcaagaaa ttatccggag aaacgttccc ctacacagcc
      601 tttgacaaca actgttatgc cttttgttgc tgggtcctgg acctaaatga ctcgtggctg
      661 agcaggagaa tgatccagag gacaactggt ttcttcaggc cctaccaaga ctggaatagg
      721 aaaccccttc ccactatgga tgactccaaa ataaagaagg tagctaacat attcctgtgt
      781 gctctgtcct cgctgttcac cagacccata aaagatataa tagggaagat aaggcctctt
      841 aacatcctca acatcttagc ctcatgtgat tggacttttg caggtatagt ggagtccctg
      901 atactcttgg cagaactctt tggagttttc tggacacccc cagatgtgtc tgcgatgatt
      961 gcccccttac ttggtgacta cgagttacaa ggacctgagg accttgcagt tgagctcgtc
     1021 cccgtggtga tggggggaat tggtttggtg ctaggattca ccaaagagaa gattgggaaa
     1081 atgttgtcat ctgctgcgtc taccttgaga gcttgtaaag accttggtgc atatgggcta
     1141 gaaatcctaa agttggtcat gaagtggttc ttcccgaaga aggaagaggc aaatgagctg
     1201 gctatagtga ggtctatcga ggatgcagtc ctggacctcg aggcaattga aaacaaccat
     1261 atgaccacct tgctcaaaga caaagacagt ctggcaacct atatgagaac acttgacctt
     1321 gaggaggaga aagccaggaa actctcaacc aagtctgcct cacccgacat cgtgggcaca
     1381 atcaacgccc tcctggcgag aatcgctgcc gcacgttctc tggtgcaccg agcgaaggag
     1441 gagctttcca gcagaccaag acctgtggtg ttgatgatat caggcaggcc aggaataggg
     1501 aagacccacc tcgctaggga agtggctaag agaatcgcag cctcccttac aggagaccag
     1561 cgtgtgggcc tcatcccacg caatggcgtc gaccattggg atgcgtacaa gggggagagg
     1621 gtcgtcctat gggacgatta tggaatgagc aaccctattc acgatgccct caggctgcaa
     1681 gaactcgctg acacttgccc cctcactcta aactgtgaca ggatcgaaaa taaaggaaag
     1741 gtctttgaca gcgatgtcat cattatcacc actaatctgg ccaacccagc gccactggac
     1801 tatgtcaact ttgaagcatg ctcgaggcgc atcgacttcc tcgtgtatgc agaagcccct
     1861 gaagtcgaaa aggcgaagcg tgacttccca ggccagcctg acatgtggaa gaacgctttc
     1921 agttctgatt tctcacacat aaaactagca ctggccccac agggtggttt cgacaagaac
     1981 gggaacaccc cacacggaaa gggcgttatg aagactctca ccactggctc ccttattgcc
     2041 cgggcatcag ggctactcca tgagaggtta gatgaatttg aactgcaggg cccagctctc
     2101 accaccttca atttcgatcg caataaggtg cttgccttta gacagcttgc tgctgaaaat
     2161 aaatatggat tgatggacac aatgagagtt gggaaacagc tcaaggatgt cagaaccatg
     2221 ccagaactca aacaagcact caagaatgtc tcaatcaaga agtgccaaat agtgtatagt
     2281 ggttgcacct acatacttga gtctgatggc aagggcaatg tgaaagttga cagaatccaa
     2341 agcgccgccg tgcagaccaa caatgagctg gctggtgccc tgcaccattt gaggtgcgcc
     2401 agaatcagat actatgtcaa gtgtgtccag gaggccctgt attccatcat tcaaattgct
     2461 ggggctgcat ttgtcaccac gcgcattgcc aagcgcatga acatacaaga cctatggtcc
     2521 aagccacaag tggaaaacac agaggagact accagcaagg acgggtgccc aaaacctaag
     2581 gacgatgagg agtttgtcat ttcatccgac aacatcaaaa ctgagggtaa gaaagggaag
     2641 aacaagactg gccgcggcaa gaagcacaca gcattttcaa gcaaaggcct cagtgatgaa
     2701 gagtacgatg agtacaagag gattagagaa gaaaggaatg gcaagtactc catagaagag
     2761 taccttcagg acagggacaa atactatgag gaggtggcca ttgccagggc gactgaggaa
     2821 gacttctgtg aagaggagga ggccaagatc cggcaaagga tctttaggcc aacaaggaaa
     2881 caacgcaagg aggaaagagc ctctctcggt ctggtcacag gctctgaaat taggaaaaga
     2941 aacccagatg acttcaaacc caaagggaaa ttgtgggctg acgatgacag gagtgtggac
     3001 tacaatgaga aactcagttt tgaggcccca ccaagcatct ggtcgagaat agtcaacttt
     3061 ggttcaggct ggggattttg ggtctccccc agtctgttca taacatcaac ccatgtcata
     3121 ccccagggcg caaaggagtt ctttggagtc cccatcaaac aaatacaggt acacaagtca
     3181 ggcgagttct gtcgcttgag attcccaaaa ccaatcagga ctgatgtgac gggcatgatc
     3241 ttagaagaag gcgcacctga gggcactgtg gtcacactac tcatcaaaag gtccactggg
     3301 gaactcatgc ccctagcagc tagaatggga acccatgcga ccatgaagat ccaagggcgc
     3361 actgttggag gccagatggg catgcttctg acaggatcca acgccaagag catggacctg
     3421 ggtactacac caggtgattg tggctgcccc tatatctaca agagaggtaa tgactatgtg
     3481 gtcattgggg tccacacggc tgccgcacgt ggggggaaca ctgtcatatg tgccacccag
     3541 gggagtgaag gagaggctac acttgaaggt ggtgacaaca aggggacata ctgtggtgca
     3601 ccaatcctag gcccagggag tgccccaaca cttagcacca agaccaaatt ctggagatcg
     3661 tccacagcat cactcccacc tggcacctat gaaccagcct atcttggtgg caaggaccct
     3721 agggtcaagg gtggcccttc actgcagcaa gtcatgaggg aacagttgaa gccattcaca
     3781 gagcccaggg gcaagccacc aaaaccaagt gtattagaag ctgccaagaa gaccatcatc
     3841 aatgtccttg agcaaacaat tgatccacct gagaaatggt cgttcgcaca agcttgcgcg
     3901 tcccttgaca agaccacttc cagtggtcat ccgcaccaca tgcggaaaaa cgactgctgg
     3961 aacggggagt ccttcacagg caagctggca gaccaggctt ccaaggccaa cctgatgttt
     4021 gaagaaggga agaacatgac cccagtctac acggctgcgc tcaaggatga gttggttaaa
     4081 actgacaaaa tttatggtaa gatcaagaag aggcttctct ggggctcgga cttggcgacc
     4141 atgatccggt gtgctcgagc attcggaggc ctaatggacg aactcaaagc acactgtgtc
     4201 acacttccca ttagagttgg catgaatatg aatgaggatg gccccatcat cttcgagagg
     4261 cattccaggt acacgtatca ctatgatgct gattactctc gatgggattc aacacaacag
     4321 agagccgtgt tggcagcagc tctagaaatc atggttaaat tctccccaga accatacttg
     4381 gctcaggtag tcgcggagga ccttctttct cctagcgtgg tggacgtggg cgacttcaca
     4441 atatcaatca acgagggtct tccctctggg gtgccctgca cctcccaatg gaactccatc
     4501 gcccactggc ttctcactct ctgcgcgctc tctgaagtca caaacctgtc ccctgatacc
     4561 atacaggcta actccctctt ctctttttat ggtgatgatg aaattgttag cacagacata
     4621 aaattggacc cagaaaaatt gacagcaaag ctcagagaat atgggttaaa accaacccgc
     4681 cctgacaaaa ctgaaggacc ccttgtcatc tctgaagacc tgaatggcct aactttcctg
     4741 cggagaactg tgacccgcga cccagctggt tggtttggaa aactggagca gagttcaata
     4801 ctcaggcaaa tgtactggac taggggtccc aaccatggag acccatctga aacaatgatt
     4861 ccacactccc aaagacccat acaattgatg tccctactgg gggaggccgc tctccacggc
     4921 ccagcatttt acagcaaaat cagcaaattg gtcattgcag agctaaaaga aggtggcatg
     4981 gatttttacg tgcccagaca agagccaatg ttcagatgga tgagattctc agatctgagc
     5041 acgtgggagg gcgatcgcaa tctggctccc agttttgtga atgaagatgg cgtcgagtga
     5101 cgccaaccca tctgatgggt ccacagccaa ccttgtccca gaggtcaata atgaggttat
     5161 ggctttggag cccgtagttg gtgccgccat tgcggcacct gtagcgggcc aacaaaatgt
     5221 aattgacccc tggattagaa gcaattttgt acaagcccct ggtggagagt ttacagtatc
     5281 ccctagaaac gctccaggtg aaatactatg gagcgcgccc ttaggccctg atttgaatcc
     5341 ctacctttcc catttggcca gaatgtacaa tggttatgca ggtggttttg aagtgcaggt
     5401 aatcctcgcg gggaacgcgt tcaccgccgg gaaaatcata tttgcagcag tcccaccaaa
     5461 cttcccaact gaaggtttga gccccagcca ggtcactatg ttcccccaca taatagtaga
     5521 tgttaggcaa ttggaacctg tgttgattcc cttacccgat gttaggaata atttctatca
     5581 ttataatcaa tcaaatgacc ccaccatcaa attgatagca atgttgtaca caccacttag
     5641 ggctaataat gccggggacg atgtcttcac agtttcttgt cgagttctca cgagaccatc
     5701 ccccgatttt gatttcatat ttttggtgcc acccacagtt gaatcaagaa ctaaaccatt
     5761 ctctgtccca gttttaactg ttgaggagat gaccaattca aggttcccca ttcctttgga
     5821 aaagttgttc acgggcccca gtagcgcctt tgttgttcaa ccacaaaacg gcaggtgcac
     5881 gactgatggc gtgctcctag gtactaccca actgtctccc gtcaacatct gcaccttcag
     5941 aggggacgtc acccatattc caggcagtcg taactacaca atgaatttgg cctcccaaaa
     6001 ttggaacagt tacgatccaa cagaagaaat cccagcccct ctaggaactc cagatttcgt
     6061 ggggaagatt caaggtgtgc tcacccaaac cacaaggaca aatggctcga cccgcggcca
     6121 caaagctaca gtgtacactg ggagcgccga cttttctcca aaactgggta gagttcaatt
     6181 tgccactgac acagacaatg attttgaaac taaccaaaac acaaagttca ccccagtcgg
     6241 tgttatccag gatggtagca ccaccccccg aaatgaaccc caacaatggg tgctcccaag
     6301 ttactcaggc agaaacattc ataatgtgca cctggccccc gctgtagccc ccactttccc
     6361 gggcgagcag ctcctcttct tcagatctac tatgcccgga tgcagcgggt accccaacat
     6421 ggacttggac tgtctgctcc cccaggaatg ggtgcaatat ttctaccagg aggcagcccc
     6481 agcacaatct gatgtggctc tgctaagatt tgtgaatccg gacactggta gggttttgtt
     6541 tgagtgtaag cttcataaat caggctatgt tacagtggct cacactggcc aacatgattt
     6601 ggttatcccc cccaatggtt attttagatt tgattcctgg gttaaccagt tctacacact
     6661 tgcccccatg ggaaatggga cggggcgtag acgtgcatta taatggctgg agctttcttt
     6721 gctggattgg catctgacgt ccttggctct ggacttggtt ccctaatcaa tgctggggct
     6781 ggggccatta atcaaaaagt tgaatttgaa aataacagaa aattgcagca agcttccttc
     6841 caatttagta gcaatctaca acaggcttcc tttcaacatg acaaagagat gctccaagca
     6901 caaattgagg ccaccaaaaa gttgcaacag gaaatgatga gagttaaaca agcaatgctc
     6961 ctagagggtg gattctctga gacagatgca gcccgtgggg caatcaacgc ccccatgaca
     7021 aaaactttgg actggagcgg gacaaggtac tgggctcccg atgctaggac tacaacatat
     7081 aatgcaggcc gcttttccac cccccaaccc tcgggggcac taccaggaag agctaatctt
     7141 agggctactg tccccgcccg gggttcctcc agcacgttct ctaactcttc tattgctact
     7201 tctgtatatt caaatcaaac cacctcaacg agacttggtt ctacagctgg ttctggtacc
     7261 agtgtctcga gcctcccgtc aactgcaagg actaggagtt gggttgagga tcaaaatagg
     7321 aatttgtcac ctttcatgag gggggcccac aacatctcgt ttgtcacccc accatctagc
     7381 agatcctcta gccaaggcac agtctcaacc gtgcccaaag aagttttgga ctcctggact
     7441 ggcgctttca acacgcgcag gcagcctctc ttcgctcaca ttcgcaagcg aggggagtca
     7501 cgggtgtaa