Typing tool

Complete norovirus genomes

KC409240  GII.4 New Orleans
 GII.P4 New Orleans

Length: 7,511 | 3 CDS

ORF1: 3..5102
ORF2: 5083..6705
ORF3: 6705..7511
LOCUS       KC409240                7511 bp ss-RNA     linear   VRL 13-MAR-2013
DEFINITION  Norovirus Hu/GII/10370/2010/VNM, complete genome.
VERSION     KC409240.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/GII/10370/2010/VNM
  ORGANISM  Norovirus Hu/GII/10370/2010/VNM
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7511)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., My,P.V., Campbell,J.,
            Farrar,J., Vinh,H., Hoang,N.V., Wentworth,D.E. and Baker,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2012) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     This work was supported by the National Institute of Allergy and
            Infectious Diseases (NIAID), Genome Sequencing Centers for
            Infectious Diseases (GSCID) program.
            The genome sequence was generated using overlapping PCR amplicons
            spanning the genome. The amplicons were pooled by sample and then
            barcoded and sequenced using Next Generation Sequencing platforms.
            The consensus sequences of the internal PCR primer hybridization
            sites were manually verified using reads from amplicons that
            spanned across the sites.
            Genome sequence lacks part of non-coding region.
            Current Finishing Status :: Finished
            Assembly Method          :: clc_ref_assemble_long v. 3.22.55705
            Genome Coverage          :: 282.7x
            Sequencing Technology    :: Sanger; Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7511
                     /organism="Norovirus Hu/GII/10370/2010/VNM"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: F"
                     /country="Viet Nam: Ho Chi Minh City"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: II"
     gene            3..5102
     CDS             3..5102
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     3..992
                     /product="protein p48"
     mat_peptide     993..2090
     mat_peptide     2091..2627
                     /product="protein p22"
     mat_peptide     2628..3026
                     /product="viral genome-linked protein"
     mat_peptide     3027..3569
                     /product="3C-like protease"
                     /note="3CLpro; calcivirin"
     mat_peptide     3570..5099
                     /product="RNA-directed RNA polymerase"
     gene            5083..6705
     CDS             5083..6705
                     /product="capsid protein VP1"
     gene            6705..7511
     CDS             6705..7511
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 gaatgaagat ggcgtccaac gacgcttccg ctgccgctgt tgctaacagc aacaacgaca
       61 ccgcaaaatc ttcaagtgac ggagtgcttt ctagcatggc tgtcactttt aaacgagccc
      121 tcggggcgcg gcctaaacag cctcccccga gggaaaaacc acaaagaccc ccacgaccac
      181 ctactccaga actggttaaa aacattcccc ctcccccacc caacggagag gatgaaatag
      241 tggtttctta tagtgtcaaa gatggtgttt ccggcttgcc tgacctttcc accgtcaggc
      301 aaccggaaga atctaatacg gccttcagtg tccctccact caatcagagg gagaatagag
      361 atgctaagga accacttact ggaacaattc tagaaatgtg ggacggggaa atctaccatt
      421 atggcctgta tgtggagcga ggtcttgtac taggtgtgca caaaccacca gctgccatca
      481 gcctcgctag ggttgagcta gcaccactct ccttgtactg gagacctgtg tacactcctc
      541 agtacctcat ctctccagac actctcaaga aattatccgg agaaacgttc ccctacacag
      601 cctttgacaa caactgttat gccttttgtt gctgggtcct ggacctaaat gactcgtggc
      661 tgagcaggag aatgatccag agaacaactg gtttcttcag gccctaccaa gactggaata
      721 ggaaacccct tcccactatg gatgactcca aaataaagaa ggtagctaac atattcctgt
      781 gtgctctgtc ctcgctattc accagaccca taaaagatat aatagggaag ataaggcctc
      841 ttaacatcct caacatctta gcctcatgtg attggacttt tgcaggtata gtggagtccc
      901 tgatactctt ggcagaactc tttggagttt tctggacacc cccagatgtg tctgcgatga
      961 ttgccccctt acttggtgac tacgagctac aaggacctga ggaccttgca gttgagctcg
     1021 tccccgtggt gatgggggga attggtttgg tgctaggatt caccaaagag aagattggga
     1081 aaatgttgtc atctgctgcg tctaccttga gagcttgtaa agaccttggt gcatatgggc
     1141 tagagatcct aaagttggtc atgaagtggt tcttcccgaa gaaggaagag gcaaatgagc
     1201 tggctatagt gaggtctatc gaggatgcag tcctggacct cgaggcaatt gaaaacaacc
     1261 atatgaccac cttgctcaaa gacaaagaca gtctggcaac ctatatgaga acacttgacc
     1321 ttgaggagga gaaagccagg aaactctcaa ccaagtctgc ctcacccgac atcgtgggca
     1381 caatcaacgc cctcctggcg agaatcgctg ccgcacgttc tctggtgcac cgagcgaagg
     1441 aggagctttc cagcagacca agacctgtgg tgttgatgat atcaggcagg ccaggaatag
     1501 ggaagaccca cctcgctagg gaagtggcta agagaatcgc agcctccctt acaggagacc
     1561 agcgtgtggg cctcatccca cgcaatggcg tcgaccattg ggatgcgtac aagggggaga
     1621 gggtcgtcct atgggacgat tatggaatga gcaaccctat tcacgatgcc ctcaggctgc
     1681 aagaactcgc tgacacttgc cccctcactc taaactgtga caggatcgaa aataaaggaa
     1741 aggtctttga cagcgatgtc atcattatca ccactaatct ggccaaccca gcgccactgg
     1801 actatgtcaa ctttgaagca tgctcgaggc gcatcgactt cctcgtgtat gcagaagccc
     1861 ctgaagtcga aaaggcgaag cgtgacttcc caggccagcc tgacatgtgg aagaacgctt
     1921 tcagttctga tttctcacac ataaaactag cactggcccc acagggtggt ttcgacaaga
     1981 acgggaacac cccacacgga aagggcgtta tgaagactct caccactggc tcccttattg
     2041 cccgggcatc agggctactc catgagaggt tagatgaatt tgaactgcag ggcccagctc
     2101 tcaccacctt caatttcgat cgcaataagg tgcttgcctt tagacagctt gctgctgaaa
     2161 ataaatatgg attgatggac acaatgagag ttgggaaaca gctcaaggat gtcagaacca
     2221 tgccagaact caaacaagcg ctcaagaatg tctcaatcaa gaagtgccaa atagtgtata
     2281 gtggttgcac ctacatactt gagtctgatg gcaagggcaa tgtgaaagtt gacagaatcc
     2341 aaagcgccgc cgtgcagacc aacaatgagc tggctggtgc cctgcaccat ttgaggtgcg
     2401 ccagaatcag atactatgtc aagtgtgtcc aggaggccct gtattccatc attcaaattg
     2461 ctggggctgc atttgtcacc acgcgcattg ccaagcgcat gaacatacaa gacctatggt
     2521 ccaagccaca agtggaaaac acagaggaga ccaccagcaa ggacgggtgc ccaaaaccta
     2581 aggacgatga ggagtttgtc atttcatccg acgacatcaa aactgagggt aagaaaggga
     2641 agaacaagac tggccgcggc aagaagcaca cagcattttc aagcaaaggc ctcagtgatg
     2701 aagagtacga tgagtacaag aggattagag aagaaaggaa tggcaagtac tccatagaag
     2761 agtaccttca ggacagggac aaatactatg aggaggtggc cattgccagg gcgactgagg
     2821 aagacttctg tgaagaggag gaggccaaga tccggcaaag gatctttagg ccaacaagga
     2881 aacaacgcaa ggaggaaaga gcctctctcg gtctggtcac aggctctgaa attaggaaaa
     2941 gaaacccaga tgacttcaaa cccaaaggga aattgtgggc tgacgatgac aggagtgtgg
     3001 attacaatga gaaactcagt tttgaggccc caccaagcat ctggtcgaga atagtcaact
     3061 ttggttcagg ctggggattt tgggtctccc ccagtctgtt cataacatca acccatgtca
     3121 taccccaggg cccaaaggag ttctttggag tccccatcaa acaaatacag gtacacaagt
     3181 caggcgagtt ctgtcgcttg agattcccaa aaccaatcag gactgatgtg acgggcatga
     3241 tcttagaaga aggcgcacct gagggcactg tggtcacact actcatcaaa aggtccactg
     3301 gggaactcat gcccctagca gctaggatgg ggacccatgc gaccatgaag atccaagggc
     3361 gcactgttgg aggccagatg ggcatgcttc tgacaggatc caacgccaag agcatggacc
     3421 tgggtactac accaggtgat tgtggctgcc cctatatcta caagagaggt aatgactatg
     3481 tggtcattgg ggtccacacg gctgctgcac gtggggggaa cactgtcata tgtgccaccc
     3541 aggggagtga aggagaggcc acacttgaag gtggtgacaa caaggggaca tactgtggtg
     3601 caccaatcct aggcccaggg agtgccccaa cacttagcac caagaccaaa ttctggagat
     3661 cgtccacagc atcactccca cctggcacct atgaaccagc ctatcttggt ggcaaggacc
     3721 ctagggtcaa gggtggccct tcactgcagc aagtcatgag ggaacagttg aagccattca
     3781 cagagcccag gggcaagcca ccaaaaccaa gtgtattaga agctgccaag aagaccatca
     3841 tcaatgtcct tgagcaaaca attgatccac ctgagaaatg gtcgttcgca caagcttgcg
     3901 cgtcccttga caagaccact tccagtggtc atccgcacca catgcggaaa aacgactgct
     3961 ggaacgggga gtccttcaca ggcaagctgg cagaccaggc ttccaaggcc aacctgatgt
     4021 ttgaagaagg gaagaacatg accccagtct acacagctgc gctcaaggat gagttagtta
     4081 aaactgacaa aatttatggt aagatcaaga agaggcttct ctggggctcg gacttggcga
     4141 ccatgatccg gtgtgctcga gcattcggag gcctaatgga tgaactcaaa gcacactgtg
     4201 tcacacttcc cattagagtt ggcatgaata tgaatgagga tggccccatc atcttcgaga
     4261 ggcattccag gtacacatac cactatgatg ctgattactc tcgatgggat tcaacacaac
     4321 agagagccgt gttggcagca gctctggaaa tcatggttaa attctcccca gaaccacact
     4381 tggctcaggt agtcgcggag gaccttcttt ctcctagcgt ggtggacgtg ggcgacttca
     4441 caatatcaat caatgagggt cttccctctg gggtgccctg cacctcccaa tggaactcca
     4501 tcgcccactg gcttctcact ctctgtgcgc tctctgaagt cacaaacctg tcccctgata
     4561 ccatacaggc taactccctc ttctcttttt atggtgatga tgaaattgtt agcacagaca
     4621 taaaattgga cccagaaaaa ttgacagcaa agctcagaga atatgggtta aaaccaaccc
     4681 gccctgacaa aactgaagga ccccttgtca tctctgaaga cctgaatggc ctaactttcc
     4741 tgcggagaac tgtgacccgc gacccagctg gttggtttgg aaaactggag cagagttcaa
     4801 tactcaggca aatgtactgg actaggggtc ccaaccatgg agacccatct gaaacaatga
     4861 ttccacactc ccaaagaccc atacaattga tgtccctact gggggaagcc gctctccacg
     4921 gcccagcatt ttacagcaaa atcagcaaat tggtcattgc agagctaaaa gaaggtggca
     4981 tggattttta cgtgcccaga caagagccaa tgttcagatg gatgaggttc tcagatctga
     5041 gcacgtggga gggcgatcgc aatctggctc ccagttttgt gaatgaagat ggcgtcgagt
     5101 gacgccaacc catctgatgg gtccacagcc aaccttgtcc cagaggtcaa caatgaggtt
     5161 atggctttgg agcccgtagt tggtgccgcc attgcggcac ccgtagcggg ccaacaaaat
     5221 gtaattgacc cctggattag aaacaatttt gtacaagccc ctggtggaga gtttacagta
     5281 tcccctagaa acgctccagg tgaaatacta tggagcgcgc ccttaggccc tgatttgaat
     5341 ccctaccttt cccatttggc cagaatgtac aatggttatg caggtggttt tgaagtgcag
     5401 gtaatcctcg cggggaacgc gttcaccgcc gggaaaatca tatttgcagc agtcccacca
     5461 aatttcccaa ctgaaggttt gagccccagc caggtcacta tgttccccca cataatagta
     5521 gatgttaggc aattggaacc tgtgttgatt cccttacccg atgttaggaa taatttctac
     5581 cattataatc aatcaaatga ccccaccatc aaattgatag caatgttgta cacaccactt
     5641 agggctaata atgccgggga cgatgtcttc acagtttctt gtcgagttct cacgagacca
     5701 tcccccgatt ttgatttcat atttttggtg ccacccacag ttgaatcaag aactaaacca
     5761 ttctctgtcc cagttttgac tgttgaggag atgaccaatt caaggttccc cattcctttg
     5821 gaaaagttgt tcacgggccc cagtagtgcc tttgttgttc aaccacaaaa cggcaggtgc
     5881 acgactgatg gcgtgctcct aggtactacc caactgtctc ccgtcaacat ctgcaccttc
     5941 agaggggacg tcacccatat tccaggcagt cgtaactaca caatgaattt ggcctcccaa
     6001 aattggaaca gttacgatcc aacagaagaa atcccagccc ctctaggaac tccagatttc
     6061 gtggggaaga ttcaaggtgt gctcacccaa accacaagga caaatggctc gacccgcggc
     6121 cacaaagcta cagtgtacac tgggagcgcc gacttttctc caaaactggg tagagttcaa
     6181 tttgccactg acacagacaa tgattttgaa actaaccaaa acacaaagtt caccccagtc
     6241 ggtgttatcc aggatggtag taccaccccc cgaaatgaac cccaacaatg ggtgctccca
     6301 agctactcag gcagaaacat tcataatgtg cacctggccc ccgctgtagc ccccactttc
     6361 ccgggcgagc agctcctctt cttcagatct actatgcccg gatgcagcgg gtaccccaac
     6421 atggacttgg actgtctgct cccccaggaa tgggtgcaat atttctacca ggaggcagcc
     6481 ccagcacaat ctgatgtggc tctgctaaga tttgtgaatc cggacacagg tagggttttg
     6541 tttgagtgta agcttcataa atcaggctat gttacagtgg ctcacactgg ccaacatgat
     6601 ttggttatcc cccccaatgg ttattttaga tttgattcct gggtcaacca gttctacaca
     6661 cttgccccca tgggaaatgg gacggggcgt agacgtgcat tataatggct ggagctttct
     6721 ttgctggatt ggcatctgac gtccttggct ctggacttgg ttccctaatc agtgctgggg
     6781 ctggggccat caatcaaaaa gttgaatttg aaaataacag aaaattgcaa caagcttcct
     6841 tccaatttag tagcaatcta caacaggctt cctttcaaca tgacaaagag atgctccaag
     6901 cacaaattga ggccaccaaa aagttgcaac aggaaatgat gagagtcaaa caagcaatgc
     6961 tcctagaggg tggattctct gagacagatg cagcccgtgg ggcaatcaac gcccccatga
     7021 caaaaacttt ggactggagc gggacaaggt actgggctcc cgatgctagg actacaacat
     7081 ataatgcagg ccgcttttcc accccccaac cctcgggggc actaccagga agagctaatc
     7141 ttagggctac tgtccccgcc cggggttcct ccagcacgtt ctctaactct tctattgcta
     7201 cttctgtgta ttcaaatcaa accacctcaa cgagacttgg ttctacagct ggttctggta
     7261 ccagtgtctc gagcctcccg tcaactgcaa ggactaggag ctgggttgag gatcaaaata
     7321 ggaatttgtc acctttcatg aggggggccc ataacatctc gtttgtcacc ccaccatcta
     7381 gcagatcctc tagccaaggc acagtctcaa ccgtgcccaa agaagttttg gactcctgga
     7441 ctggcgcttt caacacgcgc aggcagcctc tcttcgctca cattcgcaag cgaggggagt
     7501 cacgggtgta a