Typing tool

Complete norovirus genomes

KC175357  GII.4 Den Haag
 GII.P4 Den Haag

Length: 7,511 | 3 CDS

ORF1: 3..5102
ORF2: 5083..6705
ORF3: 6705..7511
LOCUS       KC175357                7511 bp ss-RNA     linear   VRL 13-MAR-2013
DEFINITION  Norovirus Hu/Norwalk/10148/2009/VNM, complete genome.
VERSION     KC175357.1
DBLINK      BioProject: PRJNA70471
SOURCE      Norovirus Hu/Norwalk/10148/2009/VNM
  ORGANISM  Norovirus Hu/Norwalk/10148/2009/VNM
            Viruses; Riboviria; Orthornavirae; Pisuviricota; Pisoniviricetes;
            Picornavirales; Caliciviridae; Norovirus.
REFERENCE   1  (bases 1 to 7511)
  AUTHORS   Madupu,R., Halpin,R.A., Ransier,A., Fedorova,N., Tsitrin,T.,
            McLellan,M., Stockwell,T., Amedeo,P., Appalla,L., Bishop,B.,
            Edworthy,P., Gupta,N., Hoover,J., Katzel,D., Li,K., Schobel,S.,
            Shrivastava,S., Thovarai,V., Wang,S., My,P.V., Campbell,J.,
            Farrar,J., Vinh,H., Hoang,N.V., Wentworth,D.E. and Baker,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-OCT-2012) J. Craig Venter Institute, 9704 Medical
            Center Drive, Rockville, MD 20850, USA
COMMENT     Genome sequence lacks part of non-coding region.
            Assembly Method       :: clc_ref_assemble_long v. 3.22.55705
            Coverage              :: 367.0x
            Sequencing Technology :: Illumina; 454
FEATURES             Location/Qualifiers
     source          1..7511
                     /organism="Norovirus Hu/Norwalk/10148/2009/VNM"
                     /mol_type="genomic RNA"
                     /host="Homo sapiens; sex: M"
                     /country="Viet Nam: Ho Chi Minh City"
                     /PCR_primers="fwd_name: Ampl_1_Forward, fwd_seq:
                     gtgaatgawgatggcgt, rev_name: Ampl_1_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_2_Forward, fwd_seq:
                     ccgcaaaatcttcaagtg, rev_name: Ampl_2_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_3_Forward, fwd_seq:
                     tcaaccaartctgcttcacctg, rev_name: Ampl_3_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_4_Forward, fwd_seq:
                     ggcaagaagcacacagcctt, rev_name: Ampl_4_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_5_Forward, fwd_seq:
                     tggyaagatcaagaagaggc, rev_name: Ampl_5_Reverse, rev_seq:
                     /PCR_primers="fwd_name: Ampl_6_Forward, fwd_seq:
                     gagrccrtccccygattttg, rev_name: Ampl_6_Reverse, rev_seq:
                     /note="genotype: II"
     gene            3..5102
     CDS             3..5102
                     /note="genome polyprotein"
                     /product="nonstructural polyprotein"
     mat_peptide     3..992
                     /product="protein p48"
     mat_peptide     993..2090
     mat_peptide     2091..2627
                     /product="protein p22"
     mat_peptide     2628..3026
                     /product="viral genome-linked protein"
     mat_peptide     3027..3569
                     /product="3C-like protease"
                     /note="3CLpro; calicivirin"
     mat_peptide     3570..5099
                     /product="RNA-directed RNA polymerase"
     gene            5083..6705
     CDS             5083..6705
                     /product="capsid protein VP1"
     gene            6705..7511
     CDS             6705..7511
                     /note="minor capsid protein"
                     /product="capsid protein VP2"
        1 gaatgaagat ggcgtctaac gacgctttcg ctgccgctgt tgctaacagc aacaacgaca
       61 ccgcaaaatc ttcaagtgac aaaatgtttt ctagcatggc tgtcactttt aaacgagccc
      121 tcggggcgcg gcctaaacag ccccccccga gggaaatacc acaaagaccc ccacgaccac
      181 ctactccaga actggtcaaa aagatccctc ctcccccgcc caacggagag gatgaagtag
      241 tggtctctta cagtgccaaa gatggcgttt ccggcttacc tgagctttcc accgtcaggc
      301 aaccggaaga aaccaatacg gccttcagtg tccctccact caaccagagg gagaataggg
      361 atgctaagga accactgact ggaacaattc tggagatgtg ggacggagaa atctaccatt
      421 atggcctgta tgttgagcga ggtcttgtgc tgggtgtgca caaaccacca gctgccatta
      481 gcctcgccaa ggtcgaatta acaccactct ccttgttctg gagacctgtg tacactcctc
      541 agtacctcat ctctccagac actctcaaga aattacacgg agaaacattt ccctacacag
      601 ccttcgacaa caattgctat gccttttgct gctgggtcct ggatctaaac gactcgtggc
      661 tgagtaggag aatgatccag agaacaactg gcttcttcag accctaccaa gattggaata
      721 ggaaacccct ccccactatg gatgattcca aattaaagaa ggtagctaac atattcctgt
      781 gcaccctgtc ttcgctattc acaaggccca taaaagacat aatagggaag ttaaggcctc
      841 tcaacatcat caacatcctg gcttcatgtg attggacttt cgcaggcata gtggagtcct
      901 tgatactctt ggcagagctc tttggagtct tctggacacc cccagatgtg tctgcgatga
      961 ttgccccctt actcggtgat ttcgagttac aaggacctga ggaccttgta gtggagctcg
     1021 tccctgtagt aatgggggga attggcttgg tgctaggatt caccaaagag aagattggaa
     1081 aaatgttgtc atctgctgca tccaccttga gagcttgtaa agatcttggt gcgtatgggc
     1141 tagagatcct aaagttagtc atgaagtggt tcttcccgaa gaaagaggaa gcaaatgaac
     1201 tggctatggt gagatccatc gaggatgcag tgctggatct tgaggcaatt gaaaacaacc
     1261 atatgaccac cttgctcaaa gacaaagaca gcctggcaac ctatatgaga acccttgaca
     1321 tcgaggaaga gaaagccaga aaactctcaa ccaagtccgc ttcacctgac atcgtgggta
     1381 caatcaacgc ccttctggcg agaatcgccg ctgcacgctc cctggtgcac cgagcgaagg
     1441 aggagctttc cagcagacca agacctgtag tcttgatgat atcaggcaga ccaggaatag
     1501 gtaagaccca ccttgccagg gaagtggcta agagagtcgc agcctccctc acaggagacc
     1561 agcgtgtagg cctcatccca cgcaatggcg tcgatcactg ggatgcgtac aagggggaga
     1621 gggtcgtcct atgggacgac tatggaatga gtaatcccat ccacgacgcc ctcaggctgc
     1681 aagaactcgc tgacacttgc cccctcactc taaattgtga caggattgag aataaaggaa
     1741 aggtctttga cagcgatgtc atcatcatca ctactaacct ggccaaccca gcaccactgg
     1801 attatgtcaa ctttgaagcg tgctcgaggc gcatcgattt cctcgtgtat gcagaagccc
     1861 ccgaggtcga aaaggcaaag cgtgacttcc cgggccaacc cgacatgtgg aaaaacgctt
     1921 ttagttctga tttctcacac ataaaattgg cactggctcc gcaaggtggc tttgacaaga
     1981 acgggaacac cccacacggg aagggcgtca tgaagactct caccactggc tccctcattg
     2041 cccgggcatc agggctgctc catgagagat tggatgagtt tgaactacag ggcccagccc
     2101 ttaccacctt caattttgat cgcaacaaag tgcttgcctt caggcagctt gctgctgaaa
     2161 acaaatacgg gttgatggac acaatgaaag ttgggaggca gctcaaggat gtcaaaacca
     2221 tgccagaact taaacaagca ctcaagaata tctcaatcaa gaagtgccag attgtgtata
     2281 gtggttgcac ctacacactt gagtctgatg gcaagggcaa tgtgaaagtt gacagagttc
     2341 agagcacctc cgttcagacc aacaatgagc tggctggcgc cctgcaccat ctaaggtgcg
     2401 ccagaatcag gtactatgtc aagtgtgttc aggaggccct gtattctatc atccagattg
     2461 ctggggctgc atttgtcacc acgcgcatca tcaagcgtgt gaatattcaa gacttgtggt
     2521 ccaagccaca agtggaaaac acagaggagg ccaccaacaa ggacgggtgc ccaaaaccca
     2581 aagataatga ggagttcgtc atttcatctg acgacattaa aactgagggt aagaaaggga
     2641 agaacaagac tggccgtggc aagaagcaca cagccttctc aagtaaaggt ctcagtgatg
     2701 aagagtatga tgagtacaag agaattagag aggaaaggaa tggcaagtac tccatagaag
     2761 agtaccttca ggacagggac aaatactatg aggaggtggc cattgccagg gcgaccgagg
     2821 aagacttctg tgaagaggag gaggccaaga tccggcaaag gatcttcaga ccaacaagga
     2881 aacaacgcaa ggaagaaaga gcttctctcg gtttggtcac aggttctgaa atcaggaaaa
     2941 ggaacccaga agacttcaag cccaagggga aactatgggc tgacgatgac agaagtgtgg
     3001 actacaatga aaaactcagc tttgaggccc caccaagcat ctggtcaagg atagtcaact
     3061 ttggctcagg ttggggcttc tgggtctcac ccagcctgtt cataacatca acccacgtca
     3121 taccccaggg cgcgaaggag ttctttggag tccccatcaa gcaaattcag gtacacaagt
     3181 caggcgaatt ctgtcgcttg aggttcccaa aaccaatcag gactgatgtg actggcatga
     3241 tcttggaaga aggtgcgccc gaaggcaccg tggtcacact actcatcaaa aggtctactg
     3301 gagaactcat gcccctagcg gctagaatgg ggacccatgc aaccatgaaa atccaagggc
     3361 gcactgttgg aggtcagatg ggcatgcttc tgacagggtc caacgccaaa agcatggatc
     3421 taggcaccac accaggtgat tgcggctgtc cctacatcta caagagagga aatgactatg
     3481 tggtcattgg agtccacacg gctgccgctc gtgggggaaa cactgtcata tgtgccaccc
     3541 aagggggtga gggggaagct acacttgaag gtggtgacag taagggaaca tactgtggtg
     3601 caccaatcct aggcccaggg agtgccccaa aacttagtac caaaaccaaa ttctggagat
     3661 catccacagc accactccca cctggcacct atgagccagc ctaccttggt ggcagggacc
     3721 ccagagtcaa ggatggcccc tcgttgcagc aagtcatgag ggaccagctg aaaccattta
     3781 cagagcctag gggcaaaccg ccaaagccaa gtgtgttaga agctgccaag aaaaccatca
     3841 tcaatgtcct tgaacaaaca attgacccac ctgagaagtg gtcgttcgca caagcttgcg
     3901 cgtcccttga caagaccact tctagcggcc atccgcacca catgcggaaa aacgactgct
     3961 ggaacgggga gtccttcaca ggcaaattgg cagaccaggc ttccaaggcc aacctgatgt
     4021 ttgaagaagg gaagaacatg accccagtct acacaggtgc acttaaggat gaattagtca
     4081 aaactgacaa aatttatggt aagatcaaga agaggcttct ctggggctcg gatttggcaa
     4141 ccatgatccg gtgtgctcga gcattcggag gcctaatgga tgaactcaaa gcacactgtg
     4201 tcacacttcc tatcagagtt ggtatgaata tgaatgagga tggccccatc atcttcgaga
     4261 agcattccag gtacagatac cactatgatg ctgattactc tcggtgggat tcaacacaac
     4321 agagagccgt gctggcagct gctctagaaa tcatggttaa attctcctca gaaccacatt
     4381 tggctcaggt agtagcagaa gaccttcttt ctcctagcgt ggtggacgtg ggtgacttca
     4441 caatttcaat caacgagggt cttccctctg gggtgccctg cacctcccag tggaactcca
     4501 tcgcccactg gcttcttact ctctgtgcac tctccgaagt tacaaatttg tccccagaca
     4561 tcatacaggc taattctctc ttctccttct atggtgatga tgaaattgtt agtacagaca
     4621 taaaattaga cccagagaag ttgacagcaa agcttaaaga atacgggttg aaaccaaccc
     4681 gccctgataa aactgaagga cctcttgtta tttctgaaga cttagatggt ttgactttcc
     4741 tgcggagaac tgtgacccgc gacccagctg gttggtttgg aaaactggag cagagctcaa
     4801 tactcaggca aatatactgg actaggggcc ccaaccatga agatccatct gaatcaatga
     4861 ttccacactc tcaaagaccc atacaattga tgtctttact gggagaggcc gcactccacg
     4921 gcccaacatt ctatagtaaa atcagtaaat tagtcattgc agagctaaaa gaaggtggta
     4981 tggattttta cgtgcccagg caagagccaa tgttcagatg gatgagattc tcagatctga
     5041 gcacgtggga gggcgatcgc aatctggctc ccagttttgt gaatgaagat ggcgtcgagt
     5101 gacgccaacc catctgatgg gtccgcagcc aacctcgtcc cagaggtcaa caatgaggtt
     5161 atggctttgg agcccgttgt cggtgccgct attgcggcgc ctgtagcggg ccaacaaaat
     5221 gtaattgacc cctggattag aaataatttt gtacaagccc ctggtggaga gttcacagta
     5281 tcccctagaa acgctccagg tgaaatacta tggagcgcgc ccttaggccc tgatctgaat
     5341 ccctatctat ctcatttggc cagaatgtat aatggttatg caggtggttt tgaagtgcag
     5401 gtgatcctcg cggggaacgc gttcaccgcc ggaaaaatta tatttgcagc agtcccacca
     5461 aattttccaa ctgaaggctt gagtcccagc caggtcacta tgttccccca cataatagtg
     5521 gatgttaggc aattggaacc tgtgttgatc cccttacctg atgttaggaa taacttctat
     5581 cactataacc agtcaaatga ttctaccatt aaactgatag caatgctgta tacaccactt
     5641 agggctaata atgctgggga agatgtcttc acagtctctt gtcgagttct cacgaggcca
     5701 tcccctgatt ttgattttat atttttggtg ccacctacag ttgagtcaag aactaaacca
     5761 tttactgtcc caatcttaac tgttgaagaa atgactaatt caaggttccc cattcctttg
     5821 gaaaaactgt tcacgggtcc cagcagcgcc tttgttgttc aaccacaaaa tggcagatgc
     5881 acgactgatg gcgtgctctt aggcaccacc caactgtctc ctgtcaacat ctgcaccttc
     5941 agaggggatg tcacccacat tgcaggttct cgtaattaca caatgaattt ggcttctcta
     6001 aactggaaca attatgaccc aacagaagaa attccagccc ctctaggaac tccagatttc
     6061 gtgggaaaga tccaaggtgt gctcactcaa accacaaagg gagatggttc gacccgtggc
     6121 cataaagcca cagtttacac tgggagtgcc cccttcactc caaagctggg cagtgttcaa
     6181 ttcagcaccg acacagaaaa tgattttgaa actcaccaaa acacaaaatt caccccagtc
     6241 ggcgtcatcc aggatggtgg caccacccac cgaaatgaac ctcaacaatg ggtgctccca
     6301 agttattcag gtagaaatgt ccctaatgta cacctagccc ctgctgtagc ccccactttt
     6361 ccgggtgaac aacttctctt ctttaggtcc actatgcccg gatgcagcgg gtatcccaac
     6421 atggatttgg attgcctact cccccaggag tgggtgcagc acttctacca agaggcagct
     6481 ccagcacaat ctgatgtggc tctattaaga tttgtgaatc cagacacggg tagggtcctg
     6541 tttgagtgca aacttcataa atcaggctat gtcacagtgg ctcacaccgg ccagcatgat
     6601 ttggtcatcc cccccaatgg ttattttagg tttgattcct gggttaatca attctacaca
     6661 cttgccccca tgggaaatgg aacggggcgt agacgtgctt tataatggct ggagctttct
     6721 ttgctggatt ggcatctgat gtccttagct ctggacttgg ttccctaatc aatgctgggg
     6781 ctggggctat caaccaaaag attgattttg aaaataacag aaaattgcag caagcttcct
     6841 tccaatttag tagtaatcta caacaggctt cctttcaaca tgataaggag atgctccaag
     6901 cacaaattga ggccactaaa aagttacaac aggaaatgat gaaagtcaaa caggcaatgc
     6961 tcttagaagg tggattctct gaaacagatg cagcccgtgg ggcaatcaat gcccctatga
     7021 caaaggcttt ggactggagc ggaacaaggt actgggcccc tgatgctagg actacaacat
     7081 atagtgcagg ccgtttttct acccctcaac cttcgggggc actgccagga agaaccaatc
     7141 ccagggcccc tatccccgcc cggggctccc ccagcacatc ttctggtgct tctactgcta
     7201 cttctatata ttcaaatcaa actgtttcaa cgagacttgg ttctacagct ggttctggca
     7261 ccaatgtctc gagtctcccg tcaactgcaa ggactaggag ttgggttgag gatcaaaaca
     7321 gaaatctgtc accttttatg aggggggctc acaacatatc gtttgtcacc ccaccatcta
     7381 gcaggtcctc tagccaaggc acagtctcaa ccgtgcctaa agaagttttg gactcctgga
     7441 ctggcgcttt caatacgcgc aggcagcctc tcttcgctca cattcgtagg cgaggggagt
     7501 cacgggtgta a